Лабковский жж: The page was not found!

Михаил Лабковский: posic — LiveJournal

http://labkovskiy.ru/

Еще один психолог, познаменитее предыдущего. Если Литвак учит, как сделать карьеру, то Лабковский — как махнуть на все рукой и просто быть счастливым.

Интервью — http://labkovskiy.ru/publikatsii/mihail-labkovskij-esli-devushka-govorit-net-ya-k-nej-vtoroj-raz-ne-podojdu/

Я прочитал вашу книгу. Если ее сократить до одного предложения, то получится «Делай только то, что хочешь, и будешь счастлив». Я правильно понял суть?

Что имеется в виду на самом деле? Когда вы принимаете решение по разным поводам своей жизни, у вас разные мотивации: здорово, правильно, целесообразно, справедливо и так далее. И есть одна мотивация, которая лишена всякого смысла: мне так нравится. Если вы научитесь, во-первых, понимать, что вам нравится, и, во-вторых, принимать решения только на основе того, что вам нравится, то есть эмоциональные, вы действительно можете быть счастливыми. И тут одна проблема: для этого надо перестать бояться. Потому что, если вы так будете жить, могут наступить последствия: вы можете потерять деньги и людей. Зато сразу начинается другая жизнь. А жить как хочется — на самом деле единственный способ прожить жизнь счастливо. И это правда.

Есть, наверное, такие высокодуховные натуры, которым хочется играть на арфе, а они таскаются в банк. Но мне кажется, большинство людей хотят просто жрать, бухать и трахаться, извините.

Ну, ни в одной из этих вещей нет ничего плохого, хотя если бухать с зависимостью, то это уже медицинские проблемы. А так, пожалуйста — делайте что хотите, это ваша жизнь. Просто рано или поздно деньги закончатся. Эта проблема решается так: любой обыватель, если он здоровый, имеет потребность не в работе как таковой, а в самореализации. Удовольствия не приносят самореализации. И если научиться слушать свои желания, неизбежно возникнет деятельность, от которой прет. Деятельность, которая со стороны будет выглядеть как работа, потому что приносит деньги, но по факту это будет любимое занятие.

Потакать своим желаниям надо учиться?

Да, каждый раз при принятии решения — куда пойти, что сделать — спросить себя: хочу я этого или не хочу? И отказываться категорически от того, что вы не любите. Никаких компромиссов. Например, открываете холодильник. Хотите перед этим одно, а там оказывается совсем другое. Вы не должны это есть. Идите в кафе за определенной едой. Если не пойдете — это компромисс, это, значит, вы тянете лямку. Вы должны доводить свои желания до реализации. Второй шаг — отказываться от того, что вам не нравится, что приносит вам ущерб.

Сплошь и рядом бывают ситуации, в которых нужно напрячься и что-то сделать ради результата, который нравится. Но процесс несколько мучителен. Что в этой ситуации делать?

Жизнь — это не анальный секс, когда сначала будет больно, а потом приятно. Надо, чтобы сразу было приятно. Моя идеология так устроена, что не надо вообще напрягаться, чтобы потом получить результат. Так что то, что вы описали, — это невротическое. То есть любая игра «достижение — преодоление» — это нездоровое.

Если любое напряжение ради результата — это невротическое, то, получается, цивилизацию двигали невротики?

Да, сто процентов.

Может, тогда не надо вылечиваться всем от невротизма?

Человеку важно не то, насколько он гений, а насколько он счастлив при жизни. Все великие — трагические личности, они страдали, умерли в страданиях. И от того, что им сейчас ставят памятники, не легче. А половину из них еще и не оценили при жизни. Моя задача как психолога — не делать из великого еще более великого, а сделать из великого — счастливого. При этом он может растерять свое величие.

Мне кажется, по этой логике человечество с дерева бы так и не спустилось.

И что, это плохо?

Я вот подумал про дельфинов. Вот были обезь­яны и дельфины. Обезьяны-невротики слезли с дерева — и вот они мы. А дельфины остались счастливыми.

Многие люди вообще плюются на цивилизацию. Говорят, что от нее все зло и идет.

А добиваться женщин тоже не надо?

Тоже не надо. Если девушка говорит «нет», я к ней второй раз не подойду. Я даже могу жалеть ка­кое-то время после, что можно было еще немного поднатужиться — и она была бы моей. Но мне этого не надо. Потому что я знаю: это ничем не закончится.

Михаил Лабковский о наших истинных желаниях

По данным ВЦИОМ, 64% россиян выступили за сохранение СССР.

27% считает, что в развале виновен Горбачёв, 13% — что Ельцин, 2% — что США, 1% — что никто не виноват. И 40% вообще не знают, как к этому относиться.

«В чём правда, брат?». А правда в том, что за развал СССР в нашей интерпретации и за отделение Российской Федерации в интерпретации жителей союзных республик «виноваты» граждане союзных республик, которые на референдумах проголосовали за «развал». Как поётся в песне, «Никто нам не поможет – не бог, не царь и не герой. Добьёмся мы освобожденья своею собственной рукой».
Понятно, что возврат к СССР может быть только насильственный (военным путём). То есть за прошедшее время ни одна бывшая союзная республика, включая родные в доску Белоруссию и Украину, не проявили желания вернуться в СССР.
Давайте познакомимся с богатым внутренним миром этих 64% россиян, желающих возврата в прошлое. Вот данные ВЦИОМ и «Левада-центра». 79% не были за границей («заграница», кстати, пишется в одно слово), 81% ненавидят США, 55% ненавидят Украину, 84% не читали конституцию, 72% одобряет враньё (искажение фактов, если это выгодно государству), 51% одобряет действия Сталина и 69% никогда не летали самолётом. Без комментариев.

Панамское расследование. Это расследование служит прекрасным наглядным уроком детям России. Родители, которые отдают детей в музыкальные школы, учат игре на музыкальных инструментах, действительно думают об их будущем. И те дети, которые отказываются, просто не знают ничего о панамском расследовании. Дорогие дети, ходите в музыкальные школы, овладевайте музыкальными инструментами. За ними будущее.

Глава Госдепа США не будет извиняться перед Японией за бомбардировку Хиросимы, а просто выразит скорбь. Вот интересно – почему? Дело в том, что в 1945 году Япония уже практически проиграла войну. Но благодаря самурайскому духу отказывалась сдаваться. Мой отец был переброшен с советско-немецкого фронта на Дальний Восток и рассказывал, что когда они вели пленных японцев, некоторые из них выбегали из строя, бросались на колени лицом к востоку и вспарывали себе живот. Отцу было 20 лет. Они все были в шоке, не понимали, что это за самоубийства. И отец сказал: я спас немало самурайских жизней, потому что подбегали, выбивали у них нож сапогом и пинками гнали обратно в строй. Это могли сделать только самураи, японские офицеры и ещё те, которые умудрились пронести нож после того, как их взяли в плен. Но по самурайской традиции самоубийство является наказанием для врага. Отец сказал, что они все были в шоке.

Япония войну фактически проиграла, и американцы предложили японцам сдаться, чтобы остановить кровопролитие. Японцы жёстко и твёрдо сказали «нет». И тогда Министерство обороны США к 1945 году подготовило доклад о том, что единственная тогда возможность прекратить войну с Японией – это сделать сухопутную операцию, которая, по их данным, должна была унести жизни больше миллиона человек, в основном, кстати, японцев и мирных жителей. Плюс к этому должны были пострадать десятки и сотни тысяч или быть убитыми солдаты США. США не хотело ни кровопролития в Японии, ни гибели своих солдат. И в их понимании бомбардировка атомной бомбой Хиросимы была единственной возможностью малой кровью, как ни странным это покажется сегодня, прекратить бессмысленное сопротивление Японии и сохранить сотни и сотни тысяч жизней самим японцам. Вот такая интерпретация и логика была в США в то время.

Конечно, бомбардировка атомным оружием – это тоже преступление. Но, как ни парадоксально, а в жизни много парадоксов, именно эта бомбардировка смогла сохранить жизни из-за того, что не было сухопутной операции. Никто не оправдывает это преступление – бомбардировку мирного города Хиросимы. Но в понимании военного руководства США в 1945 году у них не было другого выхода.

«Подскажите, как отказать в сексуальных притязаниях коллеге по работе, чтобы он понял раз и навсегда, и при этом остаться в хороших отношениях? Очень не хочется менять работу».

Отказывать надо очень конкретно. В России есть проблема, когда парень говорит девушке: может быть, пойдём, попьём кофе. Она, вместо того чтобы сказать «нет, не хочу», говорит «не сегодня, не люблю кофе, может быть, в другой раз» и так далее. И за этой неконкретностью создаёт иллюзию того, что можно, но не сейчас.
Так вот надо сказать твёрдое «нет», может быть, запастись телефоном, поставить его на запись и записать этот разговор, чтоб в случае возникновения проблем можно было предъявить запись sexual harassment (сексуального домогательства). Мне приходилось периодически иметь дело с такой проблемой у себя в консультации. И проблема в том, что у девушек часто бывает страх легализации этой ситуации: ей стыдно, неудобно – из-за этого её потом увольняют с работы. Ничего стыдного нет. Стыдно должно быть тому, кто занимается домогательством.

«Господин Лабковский, здравствуйте. Можно ли объяснить психологически рост гомо- и трансфобии в Российской Федерации? Если да, то как? Спасибо за внимание и ответ».

Не то чтобы рост гомофобии… Россия традиционно страна гомофобская. Сейчас просто все эти обсуждения вышли на уровень средств массовой информации. Но я не знаю, что я бы мог ответить. Я скажу вам, что по этому поводу говорил Фрейд. Он говорил, что вот эта яркая, жёсткая неприязнь к гомосексуалистам говорит о том, что человек сам может быть латентным гомосексуалистом. На самом деле гомофобия – это не неприязнь, а именно фобия. Слово «фобия» — это страх. Мне кажется, что рост таких негативных эмоций по отношению к гомосексуалистам связан именно со страхом. А с чем связан страх – тут хочется спросить опять покойного Фрейда, не есть ли это латентный гомосексуализм.

«Здравствуйте, подскажите, как избавиться от постоянного чувства тревоги за себя и близких».
«Всё тяжелее становится переживать и быть спокойным… ответственными делами и стрессом. Что можете посоветовать?»
.
Я хочу посоветовать следующее. Во-первых, понять, что у вас есть чувство тревожности, что вы просто тревожный человек. Такая у вас невротическая проблема. А вот дальше тревожные люди начинают размещать свои беспокойства и страх в совершенно разных аспектах. Кто-то начинает переживать за близких и родных, за болезни и смерти. Кто-то начинает переживать за работу, за то, что не справится, за то, что не сможет найти работу, за то, что денег не будет, и так далее. Если вы сами не справляетесь, идите к психологу, решайте проблемы с психологом.

«Как быть с чувством равнодушия? Оно постепенно захватило абсолютно все сферы моей жизни. Я почти ничего не чувствую, кроме гнева и обиды в конфликтных ситуациях, и то я скорее себя накручиваю».
Во-первых, у вас нет чувства равнодушия. У вас есть две главные эмоции, которые застилают все остальные – это чувство обиды и чувство гнева. Гнев и обида – это, кстати, две стороны одной медали. Так что у вас не то, что апатия, вы ничего не чувствуете. Просто, к сожалению, это большая трагедия: все ваши эмоции, весь ваш эмоциональный мир негативный. Это только гнев и обида. Когда вы избавитесь сами или с помощью психолога от гнева и обиды, мир засверкает другими красками, и вы почувствуете, что есть ещё другие эмоции, абсолютно позитивные.

«Чему посвятить свою жизнь, если тебе 55 лет и ты в корне не согласен с процессами, происходящими в обществе, тебя пугает будущее Родины…».
Слушайте, жизнь посвящать ничему не надо. Смысл жизни – это и есть сама жизнь. То, что у вас такое негативное мышление, вы концентрируете на каких-то негативных проявлениях и из-за этого теряете опору в жизни, смысл жизни – это есть психологическая проблема. Человек, если он не невротичен, он просто живёт и получает от жизни удовольствие. Если у него возникает проблема, с которой он не согласен, у него есть два решения: он может или изменить проблему, или изменить к ней отношение и принять эту ситуацию. Выбирать вам.
«Отношения с матерью, которые не приносят радости нам обеим. Отчего я чувствую себя виноватой? В её жизни много не устроено. Она ревнует меня к своей родной сестре и так далее».

Если у вас плохие отношения с матерью, это вообще базовая проблема для последующих невротических проявлений. Вам надо обязательно с этой проблемой разобраться. Почему вы чувствуете виноватой? Из-за страха, что мать умрёт раньше вас, и если вы не будете с ней общаться, а вы, видите, не хотите с ней общаться, потому что у вас тяжёлые отношения, то вам придётся с чувством вины потом жить. Это заставляет вас а) общаться с матерью против своей воли б) пытаться решать её проблемы, которые вы категорически решать не хотите в) чувствовать себя заложником этой ситуации. Всё, что вам нужно – это избавиться от страха. Да, жизнь так устроена, что родители уходят раньше детей, и это правда. С этим надо просто смириться, принять и жить в согласии с собой. Хотите общаться с мамой – общайтесь. Не хотите – не общайтесь.

«Как преодолеть желание ссориться и хамить? Почему люди в общественной, профессиональной и личной жизни так часто грубят и провоцируют скандалы?».

Это происходит потому, что у людей есть уже упомянутые тяжёлые эмоции – чувство обиды, чувство гнева, чувство унижения – именно это заставляет их хамить, скандалить, провоцировать конфликты. Если вы хотите избавиться от этого в себе, вам нужно а) понять, почему у вас есть чувство обиды и унижения б) избавиться от этих двух чувств. И вас отпустит.

«Как бороться с апатией?»
Во-первых, бороться не надо ни с чем. Нужно решать проблему апатии. Проблема апатии, или, есть такое выражение «астенический синдром», то есть снижение тонуса, снижения интереса к жизни, краски меркнут, радости всё меньше и меньше. Это тревожный сигнал к тому, что астения бывает обычно перед депрессией. Вам надо понять, что происходит. У вас синдром хронической усталости, какая-то психотравма, какая-то сложная неразрешимая ситуация в жизни, из-за которой вы начинаете всё хуже и хуже себя чувствовать, становитесь безразличным, неэмоциональным? Когда вы решите эту проблему, состояние полноты жизни, радости жизни вернётся. Если вы не будете решать эту проблему, то апатия может перерасти в депрессию, притом, в клинической форме. И это будет уже требовать медикаментозного лечения. Поэтому пока можете ограничиваться походом к психологу.

Странно, что утверждение главы РПЦ вызвало такой ажиотаж. Как глава Русской православной церкви он сказал абсолютно правильно. Никакого гуманизма, никакой ценности человека в церкви не предусмотрено. Давайте по порядку.
Во-первых, люди, паства называются «рабы божьи», то есть давайте понимать это буквально – божьи рабы, жизнь которых посвящена служению Богу. Верующие люди должны быть собой недовольны, они должны испытывать чувство совести. В психологии чувство совести и чувство вины – это когда вы себя считаете плохим человеком и вы собой недовольны. То есть дальше мы предполагаем, что люди, разделяющие религиозные идеи, себя не любят, имеют низкую самооценку, считают себя плохими и порочными людьми, считают свои интересы ничтожными по сравнению со служением Богу. Им свойственны такие вещи, как терпение, приношение себя в жертву, смирение и так далее. Что из этого списка относится к гуманизму? Вообще ничего. И уж тем более говорить о том, что интересы человека стоят превыше всего – это значит быть человеком неверующим. Для верующего человека, конечно же, превыше всего законы божьи. Никакого выбора у человека не существует. Его выбор полностью ограничен его подчинению божьим законам. Поэтому это абсолютно понятное, предсказуемое отношение к гуманизму со стороны церкви. Ничего странного я в этом не вижу. Другой вопрос: какую вы избираете позицию – церковь или гуманизм – зависит не от работы вашего интеллекта, не от образования, а зависит от того, какой у вас психологический статус, считаете ли вы себя человеком свободным или всё-таки разделяете психологию жертвы. Именно это определяет ваше место в этой истории.

Смешной случай произошёл на Кубе. Рауль Кастро перехватил поднятую руку Барака Обамы, не дал похлопать себя по плечу. Однажды мой американский товарищ мне рассказывал, что он заказал себе проститутку. Проститутка разделась, и он стал хватать её за грудь. Она вызвала полицию, потому что он не мог её хватать за грудь, этого не было в контракте. И она была категорически против, а он её не послушал. Дело в том, что на Кубе давно уже в хождении доллар, давно уже валютная зона для тех же американцев, рестораны, бары, пляжи – всё работает под них. Но как-то хочется уже красиво и гордо отдаться американцам. Не надо по плечу хлопать.

Россиянам предложили прощение долга по ипотеке за рождение детей. С одной стороны, идея, конечно, гуманная. С другой стороны – немножко смешная. Почему? Дело в том, что есть дети, которые уже родились, которые нуждаются и в медицинской помощи, и в образовании. И, кстати, в том же самом жилье. Но медицина находится на очень плохом уровне, образование плохое, медицинская помощь не только плохая – часто ещё и недоступная, продолжительность жизни в стране невысокая, дети часто болеют. И в принципе жильё, о котором идёт речь, для большинства молодых семей недоступно. Многие дети будут вынуждены уже вырасти и жить с родителями, потому что им не по карману покупать квартиру. Вместо того, чтобы решать проблемы с медициной, образованием и строительством дешёвого жилья, возникает гениальная идея: а давайте мы ничего не будем трогать, оставим всё, как есть – разрушенную медицину, разрушенное образование, очень дорогое и недоступное жильё, но при этом будем прощать часть долга.
Как в том анекдоте. «Рабинович, что вы всё время ходите по камере? Вы думаете, если вы ходите, вы не сидите?».

Немецкие евроскептики прошли в парламенты трех федеральных земель

Партии евроскептиков (выступающие за ужесточение режима миграционной политики) одержали победу в трёх землях Германии. Надо сказать, что европейские ценности последнее время начинают носить абсурдный характер. Например, если ты не убитый горем, убогий, ущербный житель какого-нибудь небольшой мусульманского государства, а гражданин Украины или еще какой-нибудь более-менее нормальной страны, то шансов стать гражданином Евросоюза у тебя практически нет. Почему так происходит, сказать трудно. Какая-то политика якобы локальности по отношению к таким странам, которые на самом деле не совсем испытывают в этом потребность.

Давайте разберёмся, в чём абсурд миграционной политики. Первое: сирийские беженцы вряд ли представляют собой тридцатилетних мужчин, которые приехали без жён и детей, зато с оружием и флагами ИГИЛ. Почему-то они при этом считаются беженцами.

Например, на сегодняшний день в Париже и Лондоне есть районы, в которые лучше не соваться и куда даже не приезжает полиция. В той же Германии были случаи насилия со стороны мигрантов по отношению к жительницам немецких городов. И полиция требовала от пострадавших не называть нападавших ни мусульманами, ни сирийцами, ни беженцами, ни мигрантами. Я считаю, что это жуткое ханжество и лицемерие. 8 марта я, в преддверии своих апрельских лекций в Тель-Авиве, выступал на израильском телевидении. В этот день прямо во время моего выступления было совершено 4 теракта: 1 убитый и 12 раненых. Так получилось, что полиции удалось застрелить прямо на месте преступления двух террористов. При этом европейские новости освещали всё по-другому: что израильтяне, мол, убили палестинцев. Когда возмущённый Израиль обратился, я как сейчас помню, к Швеции, почему они именно так трактуют, то, исповедуя эти уже полусгнившие европейские ценности, шведы сказали: а вы бы их судили? Пусть суд назвал бы их террористами – тогда были бы другие новости. Но так как в Израиле нет смертной казни, скорее всего, через несколько лет убийцы бы вышли на волю.

Понятно, что речь идёт действительно о террористах. Но вот эта такая ложная ценность, якобы гуманистическая, европейская – она, конечно, до добра не доведёт. И то, что сейчас в Германии к власти приходят не то что правоцентристские или правые партии, но по отношению к мигрантам, может быть, к мусульманам, может быть, к сирийцам, занимающие достаточно жёсткие позиции партии – это, я считаю, более-менее здоровый признак.

Вообще, действительно, я хочу ещё сказать два слова про абсурдность некоторых многих европейских ценностей. Недавно читал лекцию в Лондоне, и выяснилось, что в английских школах если мальчик другого мальчика ударил по морде, то тот должен не дать сдачи, а пойти пожаловаться директору или своему учителю. Везде стоят камеры, всё это отслеживается. Если ребёнок дал сдачи, то проблемы будут уже у него. То есть вообще, согласно этим же европейским ценностям, детей учат стучать друг на друга. Может быть, как не были бы неприятны эти правые партии или евроскептики, но что-то здоровое, мне кажется, в них есть.

Российская молодежь стремится к развитию карьеры и менее требовательна к характеру работы

Опрос российской молодёжи показал, что она последнее время начинает выбирать карьеру, при этом не очень сильно заботясь о профиле работы. То есть не так важно, чем ты занимаешься, главное – построить себе карьеру. Плохо и то, и другое. Начнём с карьеры. Что такое построить карьеру? Это а) больше зарабатывать и б) кем-то руководить, то есть проявить власть. Почему плохо? Потому что людей, молодёжь не интересует то, чем они будут заниматься. К сожалению, это выявляется ещё в старших классах школы, когда ребёнок не знает, ни куда он хочет идти учиться, ни чем он будет заниматься. Чем-нибудь. Главное, чтоб там платили, там был бы какой-то карьерный рост. А ведь работа – это неотъемлемая часть жизни и в каком-то смысле, наверное, главная, потому что человек себя самореализует в работе. И когда человеку наплевать, чем он будет заниматься, главное – деньги и карьера, то он очень несчастливо проживает свою жизнь, занимаясь делом, которое ему неинтересно. Отсюда, кстати, наша знаменитая российская некомпетентность, потому что большинство людей занимается не своим делом. А причина в том, что ещё с детства ребёнка не спрашивали, что он хочет, игнорировали его желания, его интересы. В результате он вырос, и, будучи уже подростком, реально не имеет никаких выраженных интересов к какому-либо виду деятельности.

Ко мне, например, приходят мамы таких подростков перед ЕГЭ, перед 11 классом и говорят: «Михаил, а можно как-то выявить у моего сына или у моей дочери склонность к какой-то профессии?». Я говорю: конечно, есть профессиональные тесты, где можно понять, чем хочет заниматься ваш ребёнок. Если читателю «Эха Москвы» интересно, вся работа делится на три категории: работа с бумагой, работа с механизмами, работа с людьми. Но на самом деле эти тесты вам не помогут, потому что у вашего ребёнка у самого нет никакой склонности ни к чему, потому что вы его не то что не развивали, вы не интересовались, что ему интересно. Поэтому тех, кто сейчас читает этот материал, я призываю с раннего возраста давать детям возможность себя проявлять, спрашивать, направлять их, реализовывать их желания, чтоб, когда они выросли, они точно знали, чем они хотят заниматься. Друзья мои, карьера и деньги – это не самое главное в работе. А когда вы занимаетесь своим делом, у вас будут и деньги, и карьера.

Новая экспедиция на Марс

Третья экспедиция на Марс сделана совместно Россией и Евросоюзом. Интересно, что первая экспедиция на Марс была в 1976 году и ставила своей целью выявить, как известно, сказано в этом фильме, есть ли жизнь на Марсе. Такое ощущение, как в том анекдоте – «дайте другой глобус». Потому что люди здесь то ли разочарованы жить на Земле, то ли считают Землю обречённой: постоянные войны, жуткая экология, какие-то непонятные перспективы, то потепление климата, то озоновые дыры, то таяние ледников. А вот как бы есть ещё альтернатива, и именно так трактуют Марс – как альтернативную планета, как запасной вариант. Если здесь жизнь не сложится, можно будет улететь на Марс. Можно подумать, что там по-другому. Как в том анекдоте: «Рабинович, что вы всё время ходите по камере? Вы думаете, если вы ходите, вы не сидите?». Тем не менее, вот эта последняя попытка найти жизнь на Марсе, а на Марсе есть признаки жизни, есть вода, есть метан как показатель того, что есть какая-то органическая жизнь на Марсе – это всё-таки попытка не просто геологического любопытства разобраться ещё с одной планетой. Это, мне кажется, такая мечта найти ещё одну возможность куда-то слинять.

Дело в том, что выясняется следующее. Почему с 1976 года интерес к исследованиям утих? Сказали – на поверхности жизни нет, ну что там дальше искать? А теперь выясняется: раз есть метан, раз есть вода, то очень может быть, что жизнь есть внутри, под слоем породы что-то происходит. И поэтому это ещё одна попытка. В 2018 году вторая станция будет бурить породы Марса, пытаясь найти что-то внутри: вдруг там есть жизнь, вдруг всем повезёт, и в случае какой-то земной катастрофы можно будет слинять на Марс. Как говорится, дай ты Бог, хотя лучше обустраивать жизнь здесь, а не думать о запасном варианте.

Россияне стали дольше жить и меньше пить – это Глава Минздрава Вероника Скворцова доложила президенту.

По продолжительности жизни Россия занимает 108 место из 188 стран, конкретно – между Ираком и КНДР. У мужчин около 65 лет, у женщин – 76. Поэтому вывод о том, что в среднем продолжительность жизни в России 71 год – это как средняя температура по больнице. Мужчины аж на 11 лет живут меньше женщин.

Среди главных причин смертности на первом месте болезни сердца и крови. Например, ИБС (ишемическая болезнь сердца), атеросклероз, гипертония. На втором месте онкология. То, что касается других причин смертности, на первом месте отравление суррогатным алкоголем, на втором – ДТП, на третьем – криминальные разборки, на четвёртом – самоубийство.
Мировая система страхования заставляет почти всех граждан большинства стран проходить ежегодно диспансеризацию и, естественно, сдавать анализы. Без этого вам просто не дадут страховку на следующий год, её не продлят. Это позволяет отслеживать почти все болезни на ранних стадиях развития. В России такая система страхования охватывает очень маленькую часть населения. 90% населения такую страховку не имеют, никаких обязательств по диспансеризации у них нет, и сами они к врачу не ходят. Поэтому, дорогие сограждане, если вы хотите помочь министру Скворцовой и поднять показатели продолжительности жизни в стране, пожалуйста, возьмите себе за правило: каждый год записывайтесь на приём к участковому врачу в поликлинику и сдавайте все анализы, которые требуются для диспансеризации. Это имеются в виду общие анализы: и биохимию крови, и те показатели, которые ваш участковый врач скажет, что необходимо узнать, там и онкомаркер, и всё это есть. Надо сдавать все эти знаменитые наши флюорографии. Короче говоря, если вы каждый год будете ходить к врачу и полностью проходить диспансеризацию, то есть не только у одного участкового терапевта, а у всех – эндокринолога, онколога, уролога, гинеколога и так далее, и кроме этого сдадите качественно, то есть достаточно разнообразные анализы, то даже если не дай Бог с вами что-то случится, на ранней стадии эту болезнью можно будет вылечить. У вас никогда не будет запущенных случаев типа рака в четвёртой стадии.

Детский омбудсмен России предложил ввести в школах предмет «семьеведение». На этих занятиях Павел Астахов предлагает рассказывать о семье в высоком духовно-нравственном смысле.

30 лет назад я уже преподавал в школе предмет, он назывался «Этика и психология семейной жизни». Первая глава этого учебника по этике и психологии семейной жизни была посвящена семье Карла Маркса. Секса в учебнике не было. Программа про сексуальное воспитание появилась гораздо позже. Можно, конечно, закрыть глаза на вопросы предохранения. Но Россия имеет проблемы а) ранних беременностей б) абортов и в) пьяных зачатий. К чему я это говорю? Что дело идёт не о растлении, как некоторым кажется, детей за счёт какой-то учебной программы, связанной с сексом, а дело идёт о том, чтобы в школе объяснить только вопросы предохранения, чтобы этих проблем не было. А теперь для тех, кому интересно. В России в среднем первый раз дети нюхают клей, курят сигареты, выпивают водку в 12.5 лет. Это статистика. А вступают в половую жизнь в 15.5 лет. Это примерно 9-10 класс, даже не 11. Так что когда авторы учебника захотят что-нибудь про духовное написать, пусть они немножко спустятся на землю и всё-таки помогут бедным детям не входить в грех и не плодить те проблемы, о которых я сказал выше.

В российском спорте разразился крупнейший допинговый скандал. Сразу несколько ведущих спортсменов, среди которых Мария Шарапова, уличены в употреблении запрещенных препаратов.

Сотрудников московских поликлиник отправят на курсы вежливости
Как сами врачи говорят, «поздно пить Боржоми, когда почки отказали». А вообще принудительное прохождение курса вежливости для врачей, похоже, такое же принудительное прослушивание лекций для водителей, которые делают дорожные нарушения. Понятно, что сама идея курса вежливости возникла из-за инцидентов, конфликтных ситуаций, которые часто случаются в лечебных учреждениях между медперсоналом и больными. Почему поздно? Потому что я думаю, что гораздо правильнее было, чтобы все абитуриенты, поступающие в медицинские вузы и среднемедицинские колледжи, то есть будущие медсестры и врачи, должны сначала проходить тестирование не только по поводу их каких-то психологических особенностей, конфликтности, лояльности и так далее, терпимости, например, а самое главное – способности и потребности оказания помощи людям.

Дело в том, что врач и медсестра – это очень специфическая профессия, предполагающая у человека, который этим занимается, наличие склонности к оказанию помощи людям. Люди, которые склонны к оказанию помощи, как правило, не конфликтны, с этикой у них всё в порядке. Я считаю, что профилактически гораздо эффективнее было бы это сделать до того, как эти люди выберут себе профессию, связанную со студентами медицинских вузов и училищ.

То, что касается конкретно курса вежливости – это лучше, чем ничего. Но думаю, что не очень эффективно. И вообще есть ещё одна интересная тема, связанная с медицинской этикой. Например, в России тяжелобольным, как правило, не сообщают об их болезни. Например, онкологическим больным. А в других странах сообщают. У нас считается, что надо беречь больного. А там считается, что больной, зная диагноз, будет бороться с заболеванием. Эта тема гораздо интереснее, чем вот эти самые курсы вежливости. Это уже касается медицинской этики. И, кстати, насколько я знаю медицинскую этику, то есть те же самые курсы вежливости, конечно же, преподают в медицинских вузах.

Как выбрать няню? На первом месте, я думаю, это рекомендация от твоих знакомых, у которых эта няня уже работала. Хотя и эта история может не уберечь от каких-то проблем. Поэтому здесь, как и в случае с врачами, необходимо проверять потенциальных нянь на адекватность… Давайте скажем более конкретно: есть очень много разных личностных тестов, которые учитывают такие особенности личности, как агрессивность, психопатический склад личности, способность или неспособность контролировать свои эмоции, терпимость, и, в конце концов, какие-то вещи, связанные непосредственно с работой с детьми. Потому что няни бывают разные. Одни няни прямо любят работу. В идеале вообще должны найти няню, которая любит детей и любит с ними работать. Но, к сожалению, это сложно, потому что очень многие няни – это люди других профессий, которым нужны деньги, а другой работы нету. А няням платят неплохо. Тем не менее, способность налаживать контакт с детьми, способность так называемой эмпатии, то есть сопереживания, способность не уставать от длительного общения с детьми и так далее – это те необходимые качества, которые, как я и предполагаю, с определённой долей вероятности, например, у тестирования есть так называемая валидность. Валидность – соответствие действительности. Достаточно высокая составляет до 75-80%. То есть я думаю, что тесты могут помочь выбрать правильную няню.

Треть россиян хотела бы видеть женщину на посту президента в ближайшие 10-15 лет
Не так уж много людей этого хотят. Всего-навсего треть опрошенных. Из них подавляющее большинство женщин, которые, понятно, лоббируют свои гендерные интересы. А примкнувшие к ним мужчины, наверное, находятся в иллюзии, предполагая, что женщина будет мягче. Хочу огорчить: будет жёстче. Женщины вообще более, как известно, существа эмоциональные, часто более обидчивые и часто более мстительные. В России было много правителей-женщины – Елизавета, Екатерины. Так что есть, что вспомнить. И вырванные ноздри Салавата Юлаева, дыба, на которой пытали диссидентов той поры. В общем, не всё так просто, как кажется. Почему хотят видеть женщину? Наверное, потому что в новейшей истории России женщин у власти не было. И кажется, что это могло быть как-то всё по-другому. Я думаю, что это иллюзия. Всё зависит не от пола главы государства, а от реальной психологии конкретного человека. Пожалуй, так.

В Госдуму внесён законопроект о принудительном лечении несовершеннолетних наркоманов .
В этом конечно же, есть смысл. Во-первых, существует закон, по которому даже совершеннолетний гражданин по решению суда может отправиться на принудительное лечение, если его действия, состояние и поведение могут нанести ущерб здоровью жизни его или другим людям. В этом смысле наркомания и даже алкоголизм у несовершеннолетних – это та самая ситуация, которая наносит ущерб жизни и здоровью ребёнка. Поэтому я за такой закон. Но с небольшими оговорками. В законе почему-то сказано, что эта функция возложена на родителей. Но дело в том, что очень многие несовершеннолетние наркоманы из-за родителей таковыми и стали. И первый косяк или первый стакан водки они получили как раз у себя дома. Кстати, если интересно читателю, то в России средний возраст ребёнка, который попробовал наркотик – 12.5 лет. Поэтому, кроме родителей, я бы ещё в законе учёл государственные органы, которые являются представителями интересов детей. Это администрация школы, где учится ребёнок, и органы опеки и попечительства, которые принадлежат к администрации района. Они бы тоже могли принимать участие, видимо, в суде и, соответственно, послесудебном принудительном лечении ребёнка. И плюс, наверное, нужно, чтобы центры создавались, какие-то правильные стационары детские и так далее. Тут очень много вопросов.

С 24 февраля «Фейсбук» запустил расширенные лайки, где, кроме «нравится», появились «ха-ха», «ух ты», «сочувствую» и «возмутительно» .
Как будто Фейсбук даёт возможность пользователю показать, что он не какой-то тупой, а у него богатый внутренний эмоциональный мир и он может очень разнообразно выражать свои чувства.
На самом деле всегда возникал только один вопрос. Например, читаете вы такую статью или чей-то пост, в котором написано: «Серёга умер». Вы хотите Серёге выразить соболезнование, а главное – дать понять общим друзьям, что вы этот пост видели. А там, кроме «нравится», больше обозначить никак невозможно. Всегда этого не хватало. Не хватало слова «сочувствую». Единственное, что, мне кажется, действительно имело бы смысл – это расширить только на один ещё знак «сочувствую». То, что касается «ха-ха», «круто», «ух ты!» или «возмутительно» — я думаю, это всё пустое. Но у людей пока реакция немного ироничная. Может быть, люди привыкнут и вообще забудут, как они раньше могли обходиться только одним лайком.

В Китае хотят повысить пенсионный возраст .
За последний год количество неработающих граждан в Китае увеличилось на 5 млн человек. Это огромная нагрузка на бюджет страны и на работающих. Вообще по этому пути идут многие страны мира. Европа чуть ли не каждый год увеличивает пенсионный возраст. Но я думаю, что это не самое перспективное дело. Есть страна Таиланд. В Таиланде пенсии не платят вообще. В Таиланде обеспечением пожилых людей занимаются члены их семей – внуки и дети. Государство абсолютно рассчитывает на семью. Государство уверено, что семья будет содержать пожилого человека. И даже никогда нет законопроектов или никто не побуждается внести такой законопроект о вообще каких-либо пенсиях.
Дело в том, что, например, если вы таец и вы видите в магазине какую-нибудь старушку с сумками, или вы идёте по улице и видите пожилого человека, который, например, везёт тачку с землёй к себе на огород, то будьте уверены, что с родственниками этого пожилого человека соседи перестанут здороваться и разговаривать. Семья такого пожилого человека будет подвергнута остракизму, потому что такой менталитет у тайцев, что считается естественным, что дети содержат пожилых людей – своих родителей, бабушек и дедушек. И когда не дай Бог в какой-то семье какой-то неблагодарный ребёнок вдруг не принёс маме, например, продуктов с утра и бедная мать пошла в гастроном за молоком и хлебом, будьте уверены: этот ребёнок, этот нерадивый сын будет подвергнут осуждению со стороны соседей. Поэтому Таиланд уже много лет вполне себе процветает безо всяких пенсий и тем более повышения пенсионного возраста. Вот это реально перспективный выход, но для этого надо воспитать своих граждан в духе любви и уважения к старикам.

Артём Звёздин: «Прав ли был Фрейд, утверждая, что существуют неврозы наций. Если он прав, то на какой стадии развития по Фрейду сейчас находится Россия?»

М. ЛАБКОВСКИЙ: В каком-то смысле, наверное, у каждого народа есть свои неврозы. Россия – страна особая. На мой взгляд, в России есть культ страдания. Это невроз религиозно-государственного характера. И заключается он в том, что людям уже веками внушают, что жизнь на этом свете – это страдание. И чем хуже тебе будет здесь, тем лучше тебе будет на том свете. Как любил говорить Мао Цзэдун, «чем хуже, тем лучше».

Возьмём, например, обрядовые свадебные песни. Текст примерно такой: «Жизнь моя закончилась. Мама, не отдавай меня замуж. Папа, забери меня обратно. Я боюсь, мне плохо, я хочу обратно к родителям в дом». Много таких вещей. Про службу в армии стенания, про вообще жизнь как страдание, как и унижение, а главное – терпение. Русская литература внесла свою лепту. Великие Толстой и Достоевский в каком-то смысле пропагандировали этот культ. И терпение, и унижение, и принятие боли и страдания – это, к сожалению, на мой взгляд, является неотъемлемым неврозом в психологии России. В каком-то смысле наша жизнь соответствует этой идеологии.

Артём Звёздин: Насколько эффективна техника аутотренинга для решения следствия психологических проблем?

Но чем больше я работаю психологом, тем более лояльно я отношусь ко всем психологическим идеям. Я считаю, что если человеку что-либо помогает – аутотренинг, арт- или зоотерапия – слава богу. Но я хочу обратить внимание на следующее. Наверное, кому-то самовнушение помогает избавиться от каких-то проблем. Но психика человека, как правило, реагирует не на слова, а на поступки и действия. Не на то, что вы себе внушаете, а то, что вы именно конкретно делаете, практически делаете. Давайте приведу такой пример. Женщина стесняется своей внешности, считает себя непривлекательной, некрасивой и так далее. Огромное время проводит перед зеркалом, не может выйти без макияжа на улицу, тщательно подбирает гардероб, ходит к пластическому хирургу, пытается всё у себя подправить и изменить, и, тем не менее, усугубляет свои комплексы. Можно, конечно, раздеться, встать у зеркала и, как в аутотренинге, говорить: я прекрасна, я хороша собой, я себе нравлюсь. Я вам предлагаю другое: выйди, не накрасившись, не причесавшись, не одевайте никаких каблуков, прямо в тапочках, в трениках, как есть – нечёсаная, немытая, и идите на улицу, идите в магазин, общайтесь. Позвольте себе быть такой. И вот эти практически действия гораздо эффективнее будут влиять на вашу неуверенность, чем аутотренинг.

Какие-то вещи вы боитесь сказать руководителю, например, чтобы вам прибавили зарплату или что вы хотите повышения. Вы, конечно, можете часами опять проводить у зеркала и тренироваться, как Де Ниро в фильме «Таксист», вытаскивать пистолет, но гораздо проще просто взять себя в руки, подойти и сказать: я хочу вот это, вот это и вот это. И когда вы делаете конкретные действия, то ваша психика опирается на реальные события вашей жизни, и именно тогда она меняется. Я считаю, что реальные действия эффективнее, чем аутотренинг.

Максим Колмаков: «Как бороться с ощущением, что жизнь проходит мимо?»

М. ЛАБКОВСКИЙ: Я не сторонник борьбы с чем-либо. Я думаю, что надо понять, откуда вообще берётся ощущение, что жизнь проходит мимо. Это депрессивное сознание так выглядит. Когда у человека депрессия, ему кажется, что он живёт какой-то плохой, серой, никчёмной жизнью, бессмысленной и неинтересной, а где-то существует другая жизнь, полная огней, радости, удовольствия и интересов. Не потому что это на самом деле так. Потому что его психика, будучи в депрессии, вот так себя ведёт, так заставляет его чувствовать и думать. Поэтому, если вы хотите избавиться от этого ощущения, первое – перестаньте себя жалеть и быть обиженным; второе – перестаньте завидовать, думая, что в другом месте… знаете, как говорят – «хорошо там, где нас нет». Считайте, что там, где вы есть – это лучшее место в жизни. И постепенно ваше депрессивное сознание будет меняться. Наполняйте жизнь содержанием. Проявляйте активность. У вас нет друзей – звоните, приглашайте, будьте инициатором. И тогда вам будет казаться, что ваша жизнь – это самое лучшее, что с вами может случиться.

Дмитрий Комаров: «Если он тиран в семье, как мне самого себя изменить? Реально ли это?»

М. ЛАБКОВСКИЙ: Во-первых, если вы тиран в семье, то вряд ли у вас вообще есть проблемы. Обычно желаются жертвы тиранов. И они приходят ко мне в консультацию и говорят: а что я могу делать с мужем-тираном? Потому что у тирана всё хорошо: ему все подчиняются, он всех терроризирует, все от него рыдают. И он свою невротическую тиранскую миссию абсолютно выполняет. И зачем ему меняться? Вот меняться он начинает или даже задумывается об этом в тот момент, когда всё у него рушится: когда униженная им, например, жена разводится с ним, когда дети, которых он третировал, перестают с ним общаться, вырастают и живут своей жизнью и так далее. Вот тогда, когда его тирания уже не действует, как сказал, по-моему, Андреев – «пытаетесь меня напугать, а мне не страшно», вот тогда у него возникает проблем, что с этим делать. Всегда агрессия (а тирания – это и есть агрессия) – это обратная сторона чувства обиды и унижения, каких-то детских комплексов, полученных когда-то давно. Если вы хотите избавиться от агрессии, если вы не хотите быть тираном, вам надо самому или с психологом решить проблему с чувством обиды. Люди, у которых нет обиды, никогда не бывают тиранами, они никогда не пытаются ни подмять под себя никого, ни принудить к чему-либо, ни заставить. Такой потребности нету. Такая потребность есть только у тех людей, которые в своё время пострадали от таких же тиранов, и теперь они выросли, стали тоже тиранами. Всё.

Инна Матвиенко: «Правда ли, что каждые 7 лет супруги сильно устают друг от друга, и какое лекарство самое эффективное, чтобы семьи не подвергались опасности распасться в этот период?»

М. ЛАБКОВСКИЙ: Вообще откуда взялась идея про 7 лет, когда супруги устают? От очень простой статистики: что наиболее количество разводов приходится на 7, 14 и 21 годы супружеской жизни. Я не думаю, что это семилетняя усталость. На самом деле люди биологически так устроены, что у них есть и потребность быть вместе (человек – существо социальное), и одновременно от усталости совместной жизни периодически возникает потребность побыть одному. И не раз в 7 лет, а это может происходить даже раз в неделю или в две недели. Что с этим делать? Во-первых, понимать, что такая физиология у тебя, такая природа, что ты и один не можешь быть, тебе нужна семья, и в то же время в семье ты можешь уставать и хочется побыть в одиночестве.

Должен понимать это ты и должны понимать другие члены семьи – супруги и дети. И вместо того, чтобы выяснять отношения и спрашивать «а что, ты меня видеть не хочешь?», «а что, я тебе надоел?», «я тебя что, достал?», «почему ты всё время уходишь?», «почему ты уезжаешь к маме?», «почему ты задерживаешься на работе?», «почему ты поздно приходишь домой?» и так далее – вместо этого понять, что такова природа и дать возможность человеку, может быть, 1-2 дня побыть одному – не трогать его, не доставать, а дать возможность уединиться. Может быть, он куда-то хочет пойти, жена хочет встретиться с подругами, пойти в кино, в театр, поехать к маме. Просто на 2 дня уехать в санаторий. Не надо спрашивать «что случилось?», «что не так?», «почему это происходит?». Просто дайте возможность человеку побыть одному. Тогда вы избежите не только на 7 год, а за всю свою супружескую жизнь вы всегда будете избегать конфликты между вами и ощущение усталости. Просто поняв, что все мы живые люди, каждому из нас надо друг от друга отдыхать, и это не проявление нелюбви, это просто такая человеческая природа.

Об избиении студентки в карсунском техникуме. Однокурсницы избили девочку не из-за педикулёза (у неё не было вшей). Они избили её из-за рвущейся наружу усугублённой пубертатом агрессии. Агрессия – это всегда следствие чувства обиды и унижения. Об этом расскажу как-нибудь в другой раз. А сейчас вот что – те, кто избивал и снимал, должны быть жёстко наказаны, чтобы у жертвы и всех остальных детей, которые чувствуют себя жертвами, было ощущение, что государство за них вступится, иначе обида, унижение и как следствие агрессия и нетерпимость будут только увеличиваться.

СМИ выложили ролик с избиением девушки, видимо, для рейтинга, я насчитал более 200 000 просмотров (только на LifeNews), думаю, что будет больше. Такое видео обычно смотрят люди, которые сами испытывают чувство боли, унижения и обиды, которые сами испытывают чувство страха и агрессии. Я думаю, что такого рода материалы могут показываться только в прокуратуре. В обществе и без этого очень много обид и агрессии. У нас и так телевидение обожает копаться в чужой боли, создавая ощущение, что это и есть наша жизнь и увеличивая чувство страха в обществе.

О давке на выставке Серова в Третьяковке. Люди у нас, если так можно выразиться, бездушно-духовные. В первый раз я об этом подумал пару лет назад на такой же выставке в Центральном доме художников. Это была или выставка живописи, или книжная ярмарка. Были опять километровые очереди. И это происходило на фоне какой-то то ли войны, то ли какого-то антигуманного закона.

Против закона Димы Яковлева вышло очень мало людей. Против закрытия детской онкологической больницы в Питере вышло человек 200. Против всяческих войн вообще выходят только одиночные пикеты. Зато на выставку Серова и не только Серова люди ломятся десятками и сотнями тысяч, стоят подолгу в очереди. Что это – проявление духовности? Нет. Вывод простой: культура и искусство никак не влияют на человеческую духовность, глубину сознания, способность переживать, способность испытывать сострадание и так далее.

В своё время в журнале «Сноб» я написал колонку о том, как книги и литература вообще, и искусство, и культура не влияют на наше духовное сознание и не делают нас глубже. И привёл пример Сталина. Сталин мог прочитать в день до 600 страниц. Он очень любил следующих писателей: Чехова, Гоголя, Золя. И сам писал очень неплохие стихи. Стихи я, кстати, помню, приводил. Их не стыдно было бы отдать в любой сборник. При этом, как вы знаете, он отправлял людей в концлагеря и расстреливал. Гитлер, кстати, вообще занимался живописью, любил писать акварелью. И это тоже ни на что не повлияло. Так что Серов со своими девочками и персиками никаким образом не влияет на развитие духовности наших граждан.

О конкурсе портретов Путина в ярославской школе. Верноподданические идеи отдельных учителей могут довести их до неприятностей. Представьте себе, что дело происходит не в 2016 году, а в 1930-х годах. Учительница одной из школ предложила шестиклассникам нарисовать портрет вождя. Дети с большим старанием и любовью, конечно, это сделали. Учительница вывесила их рисунки в школе. И вдруг секретарь парторганизации этой школы вызывает в кабинет учительницу и спрашивает её напрямую: зачем вы, Марья Петровна, подбиваете детей рисовать карикатуры на нашего вождя? Марья Петровна: да вы что, помилуйте, я же только из любви, я сама обожаю нашего вождя и детям хочу привить. А то, что так получилось, вы же понимаете, это дети, они же не художники, рисовать не умеют. На что секретарь парторганизации говорит: я это понимаю, и вы это понимаете. Значит, вы сознательно пошли на такое действие, прекрасно отдавая себе отчёт в том, что дети рисовать не умеют, и действительно получится карикатура. Идите пока.
После этого секретарь парторганизации остаётся в кабинете и пишет донос на Лубянку, что в нашей школе ведётся подрывная деятельность, учительница пытается уничтожить авторитет товарища Сталина, и ещё пытается внушить детям оскорбительное, неуважительное отношение к нашему вождю, заставляя их писать неумелые карикатуры, хотя мы все знаем, что портрет вождя поручают только самым известным, самым лучшим художникам. Даже простой студент художественного вуза не может себе такое позволить.

Поэтому хочется сказать по этому поводу. Как бы не переусердствовать в верноподданичестве и проявлении любви и не довести себя до греха в наше параноидальное время.


Уборщица из «Газпрома». Её машина, Mitsubishi Outlander, стоит ровно в 2 раза дешевле сумки, которую у неё украли. Поэтому я предполагаю, что, скорее всего, эту уже бывшую в употреблении сумку ей подарил кто-то из работников «Газпрома», а сама она её вряд ли покупала.

Вспоминается в связи с этим анекдот.
Суд по поводу изнасилования уборщицы в туалете.
Судья: — «Потерпевший, расскажите, как это произошло».
Уборщица: — «Я вымыла весь туалет и подошла к раковине выжать тряпку, и этот гад навалился на меня сзади и начал насиловать».
Судья: — «А вы пробовали кричать?»
Уборщица: — «А никого в здании не было. Кричи – не кричи».
Судья: — «А бежать вы пробовали?»
Уборщица: — «Да вы что, судья, по помытому?»

Про воспитательницу. Я не стал бы осуждать девушку, если она работает за копейки в детском саду, имея возможность в это время зарабатывать проституцией гораздо больше. Значит, она действительно любит детей и свою работу.

Это лучше, чем знаменитые советские истории о том, как воспитательницы открывали зимой окна, чтобы дети простудились и не смогли прийти в детский сад.

Когда я был студентом, я работал дворником в детском саду. Притом, это была Москва и Кутузовский проспект. Насколько я помню, пили все, а я ещё как самый молодой всё время бегал за водкой. Поэтому ещё раз хочется сделать вывод: видимо, воспитательница, несмотря на свои ночные занятия, как говорят американские феминистки, «это моё тело, я делаю с ним всё, что хочу». Самое главное, что днём она с любовью идёт на любимую работу.
Я даже думаю, что она занимается проституцией, чтобы позволить себе работать в детском саду, и при этом, чтобы у неё были хоть какие-то деньги.

Как стало известно, Ди Каприо хотел бы сыграть Путина , а также проявил интерес сыграть Распутина и Ленина. Почему? Дело в том, что Ди Каприо уже 5 раз номинировался на Оскар и ни разу Оскара не получал. У него только трижды Золотой глобус. А Оскара хочется. Так как у Ди Каприо, как известно, есть русские корни, видимо, русские родственники объяснили ему, что в Советском Союзе, для того чтобы получить народного артиста СССР, нужно было сыграть какого-нибудь государственного деятеля, и Ди Каприо понял, что самый короткий путь к Оскару – это сыграть Путина, Ленина или Распутина. Удачи тебе, Лёня.

Греф неточно сказал, что Россия – страна-дауншифтер из-за кризиса на рынке нефти . На самом деле это произошло из-за отсутствия какой-либо экономики, кроме продажи нефти, газа и других полезных ископаемых. Я об этом уже писал, как в советское время алкоголики продавали мебель, антиквариат и книги, и на эти деньги пили. Примерно так же от продажи наших полезных ископаемых мы и живём. Но прежде чем критиковать Грефа, нашу экономику и ситуацию на рынке нефти, я хочу вас спросить, друзья мои: если бы у вас был в кармане миллиард долларов, вы сами-то работать стали бы? О, не знаете. А зачем тогда, спросите, работать всей стране, если эти миллиарды только что были в кармане.

Подобная история была в Испании во времена Колумба. Колумб, когда разведал золото, завалил Испанию тоннами этого драгоценного металла. И испанцы вообще перестали работать. Настолько перестали работать, что стали закупать хлеб во Франции. Потом, как это всегда бывает в жизни, золото закончилось, они оказались нищими, без всякой экономики и без всякой способности к какой-либо деятельности. Потому что золото их развратило за эти, как у нас говорят, тучные годы. Начались погромы, они стали испытывать неприязнь просто до ненависти к Колумбу, обвиняя его, что он лишил их перспектив. Конечно, в результате Испания с тех пор оправилась от того кризиса, но то ли в шутку, то ли всерьёз они считают, что их экономика ещё слаба (она действительно более слабая, чем в Германии, во Франции или в Италии), что это отголоски той самой истории про золото Колумба.

Я неоднократно говорила, что личность психолога Михаила Лабковского для меня крайне неоднозначна. С одной стороны, весь его имидж — пиар. С другой — кому-то же помогает.

А вот берет ли на себя специалист ответственность за свои уроки — вопрос иного толка. Обрушивать на головы слушателей фразы: “Ну понятно, что ваша мама больная на голову” и “Вам с головой разобраться надо” – нельзя назвать деликатным подходом. Но опять же, кому-то же помогает…

Недавно в Риге прошла открытая лекция Михаила Лабковского: “Как понять свои истинные желания и научить этому детей”. Вопросов было много, а Михаил говорил и весело, и рубил правду-матку, и поддерживал, и успокаивал. Словом, работал по специальности. Самые интересные высказывания я собрала здесь:

“За нас в детстве решали, что мы будем носить, чем мы будем завтракать, куда пойдем учиться, а некоторых еще и на работу пристраивали. В результате, мы часто не знаем, чего же хотим на самом деле. И здесь причин несколько.

Во-первых, подавленная или абсолютно неразвитая эмоциональная сфера. Если в доме, по отношению к детям, было принято слово “надо”, то и будучи взрослыми они продолжают делать не то, что хотят, а то, что “надо”. В итоге, кто-то работает только ради зарплаты, а кто-то живет с мужем или женой, которых давно разлюбили. Жизнь вообще короткая и так ее прожить не очень приятно. Поэтому лучше идти на поводу своих желаний и жить так, как тебе хочется.

Но проблема в том, что не у всех эти желания присутствуют, а родители успели внушить, что чувство совести, чувство долга и много других вещей – куда важнее, чем реализация собственных желаний.

Во-вторых, и девушки меня сейчас поймут, это когда хочется одновременно и есть, и худеть — амбивалентность. Поэтому важно понимать свои истинные желания, а не метаться между выбором. Но большая часть вещей, которые мы хотим — это то, что хотели для нас наши родители и наше окружение. В итоге, у нас либо не получается жить, как хочется, либо та самая амбивалентность, когда разрывают разнонаправленные мотивации.

Когда человек себе не доверяет, то он не знает, чего же на самом деле хочет. Как только вы поднимаете свою самооценку, у вас тут же оказывается только одна версия желаний.

Если вам сегодня не хочется на работу — возьмите выходной. Если не хочется и завтра — возьмите еще один выходной. А если не хочется послезавтра — меняйте работу. И дело здесь не в лени. Лень — это или проблема с волей, или проблема с мотивацией.

Современные дети обременены очень многими обязательствами. Они должны ходить в сады и школы, у них есть обязательства по дому, некоторые перегружают детей еще и кружками. А на самом деле, нужно просто научить детей понимать: что конкретно они хотят?

Если ребенок после окончания школы не знает, чем хочет заниматься, то это связано не только с низкой самооценкой, но что важнее, с неуверенностью и страхами.

Когда вы должны принять какое-то решение, то у вас, как правило, куча мотивации: “мы договорились”, “я обещал”, “так надо” и прочее, а должна быть лишь одна: “я хочу!”. И даже в том случае, если это принесет ущерб вам или другим людям.

Вы должны научиться не терпеть ничего ни ради чего. Ни мужа ради детей, ни работу ради денег. Вы же можете уйти спокойно домой, если вам стало скучно в компании?

Оставьте ребенка в покое. Хочет, пусть делает уроки, нет – пусть играет. Именно так из него вырастет взрослый и ответственный человек. Когда вы указываете ребенку, что пора заниматься, то создаете дома очень нездоровую атмосферу, потому что дом — это зона свободная от школы. Вы там — не учительница, а ваш ребенок — не ученик. Его школа — его проблемы. Рано или поздно он должен научиться понимать, к чему приведут невыученные уроки.

Пока ребенок маленький, ему нужно немного помочь научиться ориентироваться во времени: когда он обедает, когда делает уроки, ложится спать и так далее. Но как только он вошел в этот процесс, а это все происходит в первом классе, то дальше живет сам. И вас больше ничего не касается! Если он вас спрашивает — помогаете. Если нет — считайте, что у него все хорошо. Мне кажется, что это счастливое детство для детей и счастливое время для родителей, которые не подписываются на 12-летнюю школьную каторгу.

Если ребенок вместо того, чтобы любить играть и читать любит делать уроки, то это тревожный признак и советую обратиться к психологу. Вообще дети-отличники — это, как правило, тревожные перфекционисты и им требуется помощь специалиста. Увы, ни школа, ни родители этого не понимают и требуют от детей только хорошей оценки. Нормальный ребенок учится где-то между “3” и “4” по пятибальной системе.

Если мы говорим о здоровой психике, то приоритетом является у ребенка желание узнать что-то новое и за счет этого учиться. А у взрослого — себя реализовать и за счет этого работать. Все остальное относится к сфере “надо” и об этом мы говорили.

Надеюсь, все понимают, что я немного идеализирую ситуации и не говорю о компьютерной зависимости. Компьютер, как и телевзор — 1,5 часа в будний день и 4 часа в выходные без вариантов, никаких иных договоренностей быть не может. Если на такой вариант ребенок не подписывется, то дома отключается вайфай, убирается планшет, а его телефон волшебным образом сменяется на Nokia6320.

Винить родителей в том, что они вас не заставляли учить математику или не научили игре на фортепиано — абсолютный инфантилизм. Это значит, что вы не берете ответветственность за свои поступки и за свою жизнь. Родители вообще не обязаны заставлять вас что-либо делать. И вот эта идея “сначала будет тяжело, а потом еще спасибо скажет” – даже не советская, а почти фашистская. Не надо так жить, потому спасибо никто не скажет.”

В подтверждение своей теории Михаил попросил поднять руки тех, кого родители в детстве заставляли играть на музыкальных инструментах. Выяснилось, что таких “несчастных” – около десяти человек, из которых ни один не подходил к инструменту за последний год.

“Ребенок сам должен выбрать, чем он будет заниматься и что его увлекает. Вы не должны его заставлять, но вы можете отказаться оплачивать его увлечения, если он скачет с одного кружка на другой, чтобы с его стороны тоже была какая-то ответственность.

На самом деле, мнение о том, что человек получает удовольствие от преодоления — немного православная идея. Если утрировать эту модель, то выходит, что за удовольствие нужно страдать, пахать и прикладывать усилия. Но как сказал по этому поводу Стив Джобс: “Надо работать не 12 часов, а головой”.

Вы можете воспитывать в ребенке все, что угодно, если вы не понимаете одной вещи — ребенок, в биологическом смысле, это животное. И как взрослая особь растит детеныша, показывая пример, так и наш ребенок перенимает наши привычки. И здесь играет роль даже то, как вы говорите по телефону, общаетесь с мужем или обсуждаете рабочие моменты вечером дома. Вот если вы говорите: “Опять звонила эта дура набитая” – это обязательно сработает.

Когда ребенок маленький — вы с ним бесконечно возитесь. Но проблема многих родителей в том, что они застревают на этом всю жизни. Пацану уже восемнадцать, а с ним продолжают общаться словно ему полгода. “Ты поел?”, “Шапку надел?”, “На работу устроился?”. У таких родителей нет умения говорить ни о чем и тогда дети закрываются. И в этом случае, вам надо разобраться со своей головой, а не со своим ребенком.

Когда вам что-то рассказывает ребенок-подросток — это не значит, что вы должны комментировать. Это значит, что вы должны закрыть рот и слушать. Когда они захотят — спросят. Не спросили — не судьба. Потому что многие из вас часто принимают уход за детьми за общение с детьми. А это разные вещи.

Страх смерти и болезни бывают у тех людей, которые живут плохо, постоянно боятся, что ничего в этой жизни не сделали и толком не жили. Те, кто живут в свое удовольствие — за жизнь не цепляются, стареют и умирают спокойно.

Не надо себя идеализировать. Люди должны быть такими, какие они есть, со своими тараканами.

Если у ребенка дневник исписан замечаниями и плохими оценками, то вопрос не к ребенку, а к школе. Он же поступил в общеобразовательную школу? Значит был признан психически здоровым и обучаемым. Тогда почему асболютно здоровый ребенок не хочет учиться? Видимо, причина кроется в том, что школа настолько неинтересна, или конкретные учителя так непрофессионально, или какие-то конфликты так подступили к горлу, что мешают ему быть заинтересованным. Но почему-то все начинают сразу валить на детей.

Мое мнение — ребенок по определению ни в чем не виноват, потому что он ребенок.

Никак нельзя воспитать в детях психическую стабильность, кроме как воспитать ее в себе. Поэтому не стоит удивляться, если вы сами немного псих, то и ребенок перенимает те же качества.

Если в семье напряженные отношения между мужем и женой, даже если они создают видимость спокойствия, даже если они выходят ругаться на улицу, то ребенок все понимает и все чувствует, потому что он не тупой. И это чувствует даже грудной. Даже еще в утробе матери. И все это влияет на его психику.

Научиться молчать — отличное качество и ему надо учиться. Я — психолог. Меня хлебом не корми, дай рот открыть. Но отношения с моим ребенком улучшились именно тогда, когда я замолчал. Во-первых, дочь стала чувствовать себя в безопасности: она может говорить сколько угодно и ее никто не перебьет, и папа-психолог не начнет давать советы. Во-вторых, она стала гораздо больше спрашивать, а значит, у меня больше возможностей ей помочь.

Мысли “жизнь проходит мимо” характеры для людей с депрессивным сознанием. Если уже стали одолевать такие тараканы, то начните с самых простых вещей: не ешьте, пока не поймете, чего именно хотите; не покупайте вещи из соображения практичности, пытайтесь все, что вы делаете, делать с позиции “мне нравится”, и рано или поздно это ощущение “жизнь проходит мимо” отпустит.

Фотографии: teatr.euroset.ru

— Я ее боюсь, она такая неленивая! Покоя не дает ни себе, ни мне.

Есть люди, которые даже после работы, и в выходные, и в отпуске, в общем, всегда находятся в некоем подвижном состоянии. От них в глазах рябит. Не умеют они, например, просто валяться на пляже, наблюдать за горизонтом… Нет, они нанимают катер, чтобы в шесть утра подальше от берега ловить специальную глубоководную рыбу и потом жарить ее на кухне гостиницы к ужасу шеф-повара. А в обед они уже едут осматривать какой-нибудь замок или холм, или могилу знаменитого поэта. Вечером — дискотека. А как же? Мы что, зря приехали, что ли? «Время надо проводить с пользой» — их девиз. При этом непонятно, в чем измеряется польза.

Сказать, что они получают удовольствие от своей бешеной активности? Чаще всего НЕТ. Просто они не могут остановиться и считают это большим достоинством. Мол, уж такой я человек, всё в делах, всё в делах!

При этом такие люди еще и не дают покоя никому вокруг. Особенно достается детям (не обязательно их собственным). А ну марш с дивана, чего разлегся?

Уже все сделал? Уроки письменные? А устные?

И портфель собрал (или что там у тебя вместо портфеля)?

В комнате приберись тогда! Носки валяются…

Может, хоть книжку какую почитаешь?

Тогда погулять пойди на воздух!

Ребенок смотрит с испугом и иногда действительно идет заниматься чем-то, с точки зрения взрослого, полезным. Потом снова пытается лечь. И тут вроде как можно оставить его в покое, но нет. Сторонники деятельного отношения к жизни не выносят, когда дети «ничего не делают». И снова, и снова куда-то их гонят или ведут, или начинают рассказывать про печальные судьбы бездельников и дворников.

Думаете, таким образом они приучают ребенка к труду? И он слушает упреки и внезапно понимает: действительно, что это я разлегся и как мне не стыдно?

Нет, он думает — как меня все это задолбало!

Но тут надо понимать, что люди ведут себя подобным образом не потому что такие вредные уродились, а потому что их так же гоняли собственные родители, а когда родители их родителей были детьми, старшие говорили чего и похуже . Например:

— Ишь, каникулы у него! Вот у нас никогда не было свободного времени! Мы работали с 11 лет. На заре вставали курям корм задать, потом в коровник, и в поле… Вот и выросли крепкими, работящими…

А еще задавали риторические вопросы:

Как это, чтоб у человека дел не было?

Или ты думаешь, кто-то за тебя будет в жизни что-то делать?

Не мудрено, и так сложилось исторически, что постоянная судорожная активность считается нормой, хорошим знаком и всячески одобряется социумом.

Но жизнь изменилась, перестроилась. И сейчас дело не в том, что наши предки, предки наших предков и предки их предков работали не покладая рук ради пропитания и нам нельзя отставать. Проблема в том, что во многих из нас присутствует ТРЕВОГА. Большая и зачастую необъяснимая.

Люди суетятся без видимой необходимости и результатов только для того, чтобы эту тревогу заглушить. Им кажется, что если они остановятся, что-то случится, что-то будет упущено, катастрофа и конец света. На самом деле, конечно, ничего подобного, и головой они это понимают, но голова тут ничем помочь не может.

Фото Артема Соколова «Пальцы держат стрелки»

Не справляясь с беспокойствами самого разного толка и не умея оставаться с ними один на один, «тревожные» стремятся придать смысл абсолютно любому своему действию. И если что делают, то только — с целью.

Гулять, просто гулять, прогуливаться ради удовольствия — никогда, разве что по магазинам, или мусор выбросить, хлеб купить, или пожить культурной жизнь — сходить в кино или в театр. И снова вопрос: а достигая своих целей, мелких и крупных, получают они удовольствие? И снова — нет. Тревога так просто не отпускает, им надо бежать дальше. И убегание как раз и есть симптом и следствие неспособности получить удовольствие от жизни. О том, что само удовольствие может быть целью, тревожные люди обычно и слышать не хотят.

Люди, позвольте же себе полениться! Это не стыдно, не вредно, и никто не будет вас ругать за несделанное домашнее задание, вы же взрослые. Отвыкайте от жизни в старомодном стиле «хватай мешки, вокзал уходит». Хвалите себя не за ударный труд, а за гармонию с собой.

И пожалуйста, дайте ребенку эти два часа в день, про которые я говорю на каждой лекции «про детей». Для нормального развития психики и мозга у ребенка должно быть свободное время, совсем свободное. Обязательно.

Как психолог еще раз: выигрывает не тот, кто все время тревожится и суетится, а тот, кто спокоен, уверен в себе и умеет концентрироваться в нужный момент.

Учитесь просто сидеть, лежать и ни о чем не тревожиться, не думать, не страдать, не планировать, не вести бесконечные диалоги и монологи с обидчиками, не смотреть телевизор или сериал в компе, не листать журнал. Для достижения многих вещей в этой жизни сначала требуется ничегонеделание. Войти в состояние ничегонеделания, поймать его и длить, длить… Если не можете справиться с тревогой сами, обращайтесь за помощью к специалистам — психологу, психотерапевту, психиатру. Жизнь того стоит.

Поймите, ваша фамилия не Стаханов и вам не надо укладывать пятилетку в три года. Вам бы просто жить и жить по возможности с наслаждением.

.

Лекция-консультация (с ОНЛАЙН-ТРАНСЛЯЦИЕЙ)

«Как выйти из невротических отношений»…с собой, партнером, детьми и родителями

Невротические отношения — это отношения, в которых вам некомфортно.Как выйти из таких отношений и сделать это наименее болезненным для себя способом?

Санкт-Петербург, Отель «Англетер», ул.Малая Морская, д.24

Популярная психология становится модным веянием современного общества. Михаил Лабковский работает в области семейной и индивидуальной психологии десятки лет. На семинарах и лекциях говорит со слушателями на понятном для них языке. Именно поэтому советы психолога пользуются весомым авторитетом у клиентов.

Детство и юность

Михаил Александрович родился в столице России 17 июня 1961 года. Родители мальчика относились к еврейской диаспоре, что создавало некоторые трудности в биографии Михаила. Лабковский признавался, что в детстве страдал синдромом дефицита внимания и гиперактивности. Заболевание сделало подростка неуправляемым и практически необучаемым, что не могло не приносить проблемы родителям.

Да и сам мальчик страдал от неуемной натуры. Невозможность усидеть на месте и сосредоточиться мешала достигать целей и добиваться результатов в жизни.

Собственные психологические проблемы стали причиной решения изучения психологии. Правда, до поступления в вуз подросток испробовал себя во многих специальностях. Первым рабочим местом в биографии стал зоопарк. Поначалу 14-летний школьник пытался устроиться на комбинат, изготавливающий бочки для пива. Однако на производство подростка не взяли, а вот в зоопарке встретили с радостью. В обязанности мальчика входил присмотр за кенгуру и мелкими животными.


Чуть позже, уже в студенческие годы, подрабатывал дворником в ведомственном детском саду. Именно там получил первые наблюдения взаимоотношений детей и родителей.

После окончания школы молодой человек получил диплом по специальности «Общая, семейная и возрастная психология». Кроме психологического образования, практиковал в решении вопросов семейного права. Обучение в университете зародило интерес к детальному изучению психологии как науки.

Психология

Карьера психолога началась для Лабковского с работы в школе. Устроившись на должность обычного учителя, вскоре молодой человек становится психологом. Кстати говоря, Лабковский вспоминал, что при устройстве в школу столкнулся с трудностями, вызванными происхождением. Молодого еврея не везде желали видеть в штате. В конце концов, Михаила Александровича приняли в коллектив нынешней московской гимназии №1543. Директор учебного заведения сам был евреем, поэтому лишних вопросов по национальности не возникло.


Михаил Лабковский работал учителем в школе

В 28 лет мужчина вместе с семьей уезжает в Израиль, где получает вторую степень по психологии и продолжает практику. В Иерусалиме занимал должность консультанта, работающего с семейными парами на стадии развода. Уникальная профессия, аналогов которой в России не существует, предполагает, помимо психологических консультаций, также решение правовых вопросов о разделе имущества и прав на детей.

При столичной мэрии работал консультантом по работе с трудными подростками. Помимо этого, не прекращалась частная консультация.


Вернувшись в Москву, вплотную занялся вопросами семейной психологии, воспитания детей и личностного роста. Популяризация науки, разговор о психологии простым, понятным обывателям языком – основная цель специалиста.

Первыми труды и советы Лабковского оценили женщины, ведь на них, жен, матерей и хранительниц домашнего очага, в первую очередь рассчитаны консультации психолога. Помимо частных встреч с клиентами, профессионал проводит семинары и лекции, которые разительно отличаются от скучных заумных цитирований теории. Чаще всего проблемные ситуации психолог рассматривает на примерах из жизни и практики.


Семинары проходят в режиме общения с аудиторией, лектор отвечает на вопросы слушателей и дает советы.

Лабковский разработал список универсальных правил, позволяющий достичь комфорта и избавления от личностных проблем. В числе прочих применений этот список остается и 6 правилами успешной женщины, вот они:

  1. Делать только то, что хочется.
  2. Не делать того, чего делать не хочется.
  3. Сразу говорить о том, что не нравится.
  4. Не отвечать, когда не спрашивают.
  5. Отвечать только на вопрос.
  6. Выясняя отношения, говорить только о себе.

На следовании этим правилам и на внедрении их в жизнь пациента и построен метод Лабковского.

С 2004 года карьера Лабковского выходит за рамки практикующего частного психолога. Специалист начинает вести радиопередачу на станции «Эхо Москвы». Программа носит название «Взрослым о взрослых» и ориентирована на решение гендерных и семейных проблем. Позже проект перенесен на канал «Серебряный дождь».


Михаил Александрович – частый гость канала «Культура», передачи «Правила жизни». Там как на лекциях и семинарах психолог отвечает на вопросы о детях, семье, самооценке, отношениях с родителями, близкими и обществом. Помимо этого, психолог ведет постоянную авторскую колонку на портале «Сноб». Советы читателям и статьи публикуются на официальном сайте Лабковского.

Кстати говоря, Михаил – активный пользователь интернет-среды и социальных сетей. Помимо официального сайта , ведет страницы на

Так сложилось исторически, что люди в России на физиологическом (не говоря уже о психологическом) уровне не в состоянии сделать свой свободный жизненный выбор и следовать ему без угрызений совести и попреков родни.

Михаил Лабковский Snob.ru

Ну, и как следствие, первое из моих «Шести правил Лабковского» — «Делать только то, что хочется» вызывает много вопросов, сомнений и даже возмущения. Ежедневно я сталкиваюсь с непониманием и сопротивлением по этому пункту. Я слышу, что жить как хочешь — это невозможно, опасно и вредно, эгоистично и противоречит сразу всем правилам мирного сосуществования. Что в корне неверно.

Все мы знаем таких людей — посадишь — сидят, поставишь — стоят. Положишь — лежат. Их много, их большинство, особенно среди тех, кому за 40. Они не слышат своих желаний или вовсе их не имеют. Желания у них или подавлены или замаскированы. И они будто и не живут, а только решают проблемы одну за другой. Год за годом. Если проблемы вдруг заканчиваются, они начинают их выдумывать — с проблемами комфортней и понятней.

Главное чувство в их жизни — чувство долга. Главное слово — слово «надо». Главный страх — как бы чего не вышло.

А лица такие, будто все время в покер играют.

Установка, данная им родителями, состоит в том, что если жить как хочется, то за это обязательно придется платить. (У родителей были на то свои исторические, социальные, наследственные причины, винить их не надо, но сейчас не об этом). В результате уже на стадии едва намечающегося счастья человек начинает бояться, что скоро все закончится, а дальше станет хуже, чем было.

Поэтому, когда надо выбирать, они выбирают нечто безопасное, нейтральное, никакое. Институт, где меньше конкурс и близко от дома, работу, где не будут много требовать, женятся не на той девочке, в которую страстно влюблены, а на той, которая гарантированно не уйдет к другому. (Выходят не за любимого, а за надежного). И ведут скучную, однообразную жизнь, отрабатывая сценарии — социальный, родительский. Учатся, работают, растят детей, ходят летом в походы, зимой — в театр. Не потому что им этого хочется, а потому, что с их точки зрения так и должна выглядеть «нормальная» жизнь.


Одним из медицинских последствий отсутствия желаний является астенический синдром, упадок сил, потеря тонуса. А крайним его выражением — депрессия. Когда человек либо вообще ничего не хочет, либо хочет только лечь и умереть (при суицидальной депрессии). И ведь некоторые проводят в этом состоянии большую часть жизни. Они ежедневно что-то преодолевают, с чем-то борются и считают, что это единственный способ преодолеть земную юдоль.

Люди в большинстве своем совершенно не получают удовольствия от жизни, и это, я считаю, большая трагедия. Целая страна, миллионы людей живут, не подозревая, что бывает по-другому, без драм, насилия над собой, без тотального чувства вины и стыда.

У большинства внутреннее «надо» настолько довлеет над всем остальным — над «хочу, «мечтаю», «могу», что когда они делают то, что хотят, то чувствуют себя хуже, чем когда делают что должно. Это жесткие невротики, которые живут с огромной тревогой в душе. У них подавлены не только желания, но и любые эмоции.

А причина всего этого — холодные нечуткие родители, которые игнорировали, не уважали, не придавали никакого значения желаниям ребенка. Отсюда же, из семьи традиционная для россиян готовность подчиняться, унижаться, смиряться, терпеть лишения. Как и уверенность, что их настоящее мнение ничего не значит и никого не интересует. Для нас в этом нет ничего нового, ведь в детстве мы все это проходили. Как и наши родители…

Мы — общество несвободных людей, для которых несчастье и общая подавленность — норма жизни. В России ведь даже боятся, когда хорошо. Есть такая общенациональная идея, что «за хорошо» придется платить. А тревога по поводу того, что платить придется уже скоро — это общенациональная эмоция. Все так и хотят заморочиться прямо во время оргазма! Так давайте разорвем этот порочный круг, прервем цепочку нелюбви и несвободы, начинающуюся прямо в утробе матери. Никогда не поздно это сделать. И давно пора.

Как бы ни было — если у вас тоже проблемы с желаниями, попробуйте их тренировать. Начните с малого. Садясь за стол, не начинайте есть, пока не решите, чего именно вам хочется, для начала в мелочах. Посвятите этому время, подумайте над тем, какой у вас любимый цвет, любимый фильм, книга… Мини или макси? Чай или кофе? Всмятку или в мешочек? Помните, что желания никак не связаны с рацио, логикой, «правильным выбором». Этот выбор не может быть неправильным.

Заново учитесь слушать и слышать себя вместо того, чтобы идти на поводу у чужих желаний. Развивайте свои способности и таланты, реализуйте свои маленькие задумки, мечты, цели. Не бойтесь быть плохими в глазах «коллектива» — это же ваша жизнь! Окружающим по большому счету на вас наплевать — у них своя есть…

Все мы завидуем людям, которые заходят в магазин, берут с вешалки вещь и сразу идут в кассу. И тут же у кассы переодеваются в новое. Мы восхищаемся ими и хотим от них детей. Ибо эта уверенность и определенность касается и всего остального в их жизни: профессии, места работы, места жительства, выбора партнера и марки автомобиля…

Как они такими выросли? Просто им с детства давали право голоса и право выбора, они с малых лет знали, что их желания значимы для других и для мира, что их желания адекватны и выполнимы, что их желания обычно материализуются! Поступайте так по отношению к своим детям, доверяйте им и у них появится шанс…

Другая проблема, когда желаний слишком много и вы никак не можете остановиться ни на одном из них. Бороться с амбивалентностью можно только задавшись целью доводить каждое свое желания (до абсурда) до его полной реализации. Решили — держитесь. Собрались с подругой в кино на 20.00? Но вам позвонили и пригласили выпить? Нет, вы уже идете в кино и никакие «вновь открывшиеся обстоятельства» не могут служить причиной изменения в планах.

Если будете держаться этой стратегии достаточно долго, отвыкнете метаться, начнете принимать решения более взвешенно и придерживаться их не будет составлять для вас труда. Результат зависит от того, насколько вы пострадали от собственной «внезапности и противоречивости», насколько вас достали метания и куча вещей в шкафу, которые вы купили по необъяснимой причине и так ни разу и не надели…

Как получать удовольствие от жизни? 6 простых правил от психолога Михаила Лабковского

Если библейское смирение и пощечины вам надоели, а древняя установка «бей или беги» перестала работать, задумайтесь о любви к себе и желаниях, что откладывали в ящик. Но недолго жизнь одна, а время «тик-так». Амбициозный и бескомпромиссный психолог Михаил Лабковский вывел шесть простых правил, колесит по миру с лекциями о том, как получать от жизни удовольствие и в ус не дуть, чего и вам желает.

 

  1.       Делайте только то, что хотите.
  2.       Не делайте того, чего не хотите.
  3.       Если вас что-то задевает, говорите об этом сразу же. Никаких затаенных обид.
  4.       Не говорите, когда вас не спрашивают.
  5.       Отвечайте только на тот вопрос, который вам задают.
  6.       Выясняя отношения, говорите только про себя.

 

Расскажите, как вывели шесть правил? В чем их сила?

Вывел примерно как Менделеев свою таблицу – интуитивно. То есть я их специально не разрабатывал, работал психологом больше 30 лет, и, видимо, они сами сложились.  А что касается силы, они дают возможность человеку в любом возрасте начать жизнь сначала. Идея такая: человек формируется примерно до пяти-восьми лет практически полностью, а потом всю жизнь отрабатывает эту модель поведения. Психика работает как компьютер: мозг воспринимает все, что с человеком происходит, как аналог детских ситуаций, где уже сформированы психические реакции и нейронные связи. И выдает те реакции, которые ребенку уже знакомы, и у взрослого воспринимаются как аналог, поэтому многие люди всю жизнь страдают. И в детстве страдали, и сейчас страдают: депрессивные, тревожные, не бывают счастливы, чувствуют, что их не любят. Эти правила дают возможность полностью изменить психические установки и сформировать здоровые реакции, без надрыва, тревоги, волнений, без низкой самооценки, создать совсем другую психологию – счастливую и жизнерадостную.

В одном из интервью вы задумываетесь о возможности получить Нобелевскую премию (воздействие правил на либидо человека). Занимаетесь ли вы исследованием этого вопроса?

Это шутка на самом деле. (Смеется.) В каком-то смысле, наверное, не в научном, а в практическом, конечно, занимаюсь исследованием. Более того, меня пригласили читать лекции в Кембридж и Оксфорд. Притом даже не для студентов, а докторов, которые продолжают обучение. В общем, многие заинтересовались этой историей.

Почему вы не утешаете своих клиентов?

А как мне их утешать? Или вы считаете, что хирург, который делает операцию, должен еще и рыдать одновременно над больным? Я думаю, что я их поддерживаю, а это больше чем утешение. Позиция утешения – это плохо, она не конструктивная.

Чтобы стать здоровой личностью, необходимо проработать детские переживания или существует другой способ освобождения?

Я, конечно, для приличия спрашиваю у пациентов про маму с папой, но не акцентирую внимание, потому что это никак не влияет на терапию. Для общего представления, как говорится, дело Фрейда живет. Надо работать над теми проблемами, которые есть у человека сегодня.

Но есть травмы, которые держат человека с детства?

Это не совсем так, как вам кажется. Вы, например, думаете одно, а на самом деле – причина может быть в другом. Вы вините родителей, а возможно, грудного ребенка поместили в стационар на неделю, и вышел он оттуда полным психом и невротиком. Родители тут вообще ни при чем. Или родители нормальные люди, но у них какие-то генетические проблемы – замучаетесь искать виновных. Поэтому я не вижу в этом никакого смысла.

Чтобы стать здоровым, согласно вашим правилам, нужно избегать или устранять боль. Но разве боль это не катализатор роста?

Для мазохистов – это специальное удовольствие. (Улыбается.) Вы знаете, боль – главное чувство у людей страдающих. Как правило, они пережили в детстве чувство обиды и унижения. Людям это дает в результате или подавленность, или, наоборот, агрессию. Боль не делает человека ни лучше, ни глубже, если вы об этом.

Может появиться азарт стать лучше, возвысится над болью, двигаться дальше…

Моя методика не предполагает становиться лучше. Я вообще против того, чтобы кого-то идеализировать. Считаю, что у всех свои тараканы, у меня свои, кстати. Я за то, чтобы избавиться от того, что отравляет и мешает радоваться жизни – это все. Никаких других целей – вроде самосовершенствования, личностного роста – я перед собой не ставлю.

Каким образом мы теряем себя, подстраиваемся под чужие представления, ищем компромиссы?

Это страхи, и их много. Страх конфликта, что тебя не полюбят, – поэтому ты на все соглашаешься. Страх, что от тебя уйдут, – и ты опять все проглатываешь, цепляешься за людей.

Откуда появилось устойчивое представление о том, что любовь – это страдание, а отношения – труд и поиск компромиссов для обоих?

Мы, и Россия, и Беларусь, живем в христианской сфере. С точки зрения религиозной традиции, так оно и есть. Например, песни венчальные в России, как в Беларуси, на одну тему: жизнь моя закончилась, мама не отдавай меня, папа забери обратно. Поэтому и культура страдальческая. А вообще, религия и есть боль и страдания, с этим трудно поспорить.

Почему отношения не нужно строить? Как быть с красивой историей «вместе и до конца: в горе и в радости»?

Если у вас так получается – здорово. А что строить-то? Вот представьте ситуацию: у вас есть ребенок и вы его то любите, то не любите, то он вас напрягает, раздражает. Вы твердите себе, что вы же мать хорошая, должны как-то выстраивать отношения, терпеть, находить общий язык. Ребенок будет считать, что вы его просто не любите. Что на самом деле правда. Любовь – это принимать человека таким, какой он есть, и не требует никакой работы.

Да, но ребенка мать любит безусловно, а это другая биохимическая связь.

Простая история – так как люди сами себя не очень любят, они и других не умеют любить. И детей, кстати, они тоже безусловно не любят. В корне проблема в низкой самооценке и нелюбви к себе.

Как быть с желанием отдавать любовь и себя без остатка? Как при этом не задушить и не навредить другому человеку?

К любви примешивается еще гиперопека, когда необходимо все время контролировать ситуацию, это тоже со страхами и тревогой связано.

По моим наблюдениям, такое часто происходит с женщинами от переизбытка чувств.

Нет, это не от переизбытка чувств, не преувеличивайте. Когда человек боится, он пытается все контролировать. Лезет в жизнь другого, навязывает ему что-то. Это не от избытка любви, а от того, что у него куча проблем психологических.

Когда человек обжигается более одного раза, часто становится более осторожным и замкнутым, боится быть слишком открытым и доверчивым. Как распознать своего человека? Ведь доверие не происходит само по себе, оно вырастает постепенно?

Никто вам ничего гарантировать не может. Отсутствие внутренних страхов открывает возможность встретить адекватного мужчину. Жить спокойно и ничего не бояться, а если не сложится, то не сложится. А когда вы боитесь, вокруг вас и мужчины дерганые должны быть, а если вы об этом еще и думаете постоянно, то у вас нездоровые отношения получаются изначально.

Какие общие проблемы существуют сейчас у людей?

Есть три блока. Первый – это проблемы личностные, то есть с самим собой. В частности, неспособность радоваться, неуверенность в себе, неумение реализовывать свои желания и так далее. Второй – это проблемы взаимоотношений, видимо, ваши любимые. И третий – это дети.

Как на вас отражаются многочисленные истории ваших клиентов?

Они никак на мне не отражаются.

Как вам это удается?

Мало работаю. Я больше лекции читаю, чем принимаю пациентов. Я занимаюсь психологией уже более тридцати лет и подустал. У меня дорогая консультация, и я не работаю по восемь часов в день, и даже не каждый день принимаю.

Раньше много сил уходило?

Конечно. Здесь не то что много или мало, я всю жизнь этим занимался, где-то с 23 лет. Сейчас мне 55. Любопытная история: когда я стал выздоравливать сам, мне стало неинтересно копаться в чужих проблемах. Поэтому лекции я люблю гораздо больше.

Что произошло? Вас отпустило?

Золотые слова. Меня правда отпустило, лучше не скажешь.

А раньше вы находили что-то общее со своим пациентами, их истории помогали вам?

Да, все подряд. Дело в том, что у самих психологов проблемы есть, это понятно.

Можете ли вы сказать, что любите людей?

Да, я стал гораздо лучше относиться к другим, и здесь есть закономерность – чем лучше относишься к себе, тем больше любишь людей. И наоборот.

Читайте также:

Зарплата – это та сумма, на которую вы себя чувствуете

В каком случае низкая самооценка становится препятствием на пути к успешной карьере?

— Тогда, когда человек не может реализоваться, найти себя.

Начинается это еще в школе. Ребенок плохо учится, его шпыняют, он еле сдает выпускные экзамены и выбирает не профессию, к которой душа лежит, а ВУЗ, в который есть шанс поступить. На работу устраивается по тому же ущербному принципу. Вакансия – попроще, еще на собеседовании работодателю становится ясно, что соискатель не уверен в себе, ни на что не претендует, что ему можно поручить рутину, свалить множество скучных обязанностей: ни жаловаться, ни тем более требовать большой зарплаты и должности он не будет. И вот человек соглашается на то, что ему не очень-то нравится. А чего сам хочет, даже и не знает по-настоящему…

Мне часто приходится консультировать жен состоятельных людей, и я их спрашиваю: «А чем бы вы хотели заниматься в жизни?» И почти всегда выясняется, что собственных идей и желаний у них нет. Почему нет – другой большой вопрос про детство, родителей, которые подавляли, не считались с желаниями и просьбами ребенка и в результате вырастили человека, который не любит и не понимает себя. А как результат — не находит свое предназначение и проживает жизнь, в которой то и дело смиряется с обстоятельствами.

Уверенность в себе — это то самое качество, которое в первую очередь дает хорошее образование (например, частные британские школы). Как быть тем, у кого нет денег на дорогое образование?

— Вы знаете, где выдают уверенность в себе? Я вот не думаю, что учеба в частной британской школе – залог успеха. Есть статистика, факты: у многих миллионеров с образованием все очень запущено. Иногда его просто нет. При этом (и, возможно, именно поэтому) у них отсутствует страх перед неудачей, они умеют нестандартно мыслить, рисковать, плюют на правила и авторитеты. Разве этому учат в школе? По моим наблюдениям для успеха в бизнесе в первую очередь нужно ничего не бояться.

А частные британские школы – это ведь продукт на экспорт. Учат ли там самостоятельности, умению принимать решения, отвечать за свои поступки, отстаивать свое мнение, общаться, дружить? Мне кажется, что и двоечник из государственной школы в бедном районе может стать успешным бизнесменом, и выпускник престижного частного колледжа может оказаться неудачником. Все индивидуально!

Моя дочь училась в бесплатной государственной школе в Иерусалиме. Это школа, которую окончили братья Нетаньяху, один из которых является действующим премьер-министром Израиля. И хотя училась она там только до 8-го класса, знания получила серьезные, и английскому научили прекрасно.

Какие еще качества нужны человеку, который хочет добиться успеха?

— Человеку должно нравиться то, что он делает, он должен ХОТЕТЬ ДЕЛАТЬ ИМЕННО ЭТО, понимать свои желания и следовать им. А в остальном – важна опять-таки уверенность в себеумение доверять своим решениям, желаниям, чутью; понимание причинно-следственных связей; способность ставить большие цели и совершать большие поступки.

Какую роль амбиции играют в достижении успеха?

— Смотря что считать успехом. Я не рассматриваю деловой успех в отрыве от элементарного человеческого благополучия. Богатые, успешные в бизнесе люди очень часто бывают несчастными. Я их пачками видел – большинство из них реальные невротики.

Амбиции ведь возникают, когда человек не нравится себе в своем нынешнем виде и лезет из кожи вон, чтобы доказать, что он чего-то стОит. Он постоянно сравнивает себя с другими и все время проигрывает это сравнение в своих глазах. Происходит смещение целей. Вместо того, чтобы воплощать в жизнь собственные устремления, реализовывать свои таланты, способности, желания и мечты, человек напрягается, жизнь кладет, потакая своим амбициям и, пытаясь выиграть какое-то соревнование, навязанное самому себе… Ну, допустим, выиграл. Счастлив он? Не факт.

Я стою на том, что амбиции здоровыми не бывают. И точка.

Бывает, что человек утрачивает самооценку из-за жизненных неудач  — например, долго не может найти работу…

— Наша самооценка очень избирательна. Здоровая ситуация, ситуация нормы – это когда человек принимает и любит себя всего целиком. Все ему в себе нравится: и внешность, и животик, и лысина, и то, как он мыслит, и как общается… И как раз это-то не часто встретишь. Обычно люди говорят о себе так: «Я себя оцениваю объективно – как работник я хорош, но как руководитель не тяну» или «внешность у меня яркая, но убеждать я не умею». Идет это, конечно же, тоже из детства, если родители делали акцент на каких-то качествах ребенка, например, мама говорила подружке по телефону: «Она у нас страшненькая, но старательная» или «Сынок, хоть и туповат, мыслителем ему не бывать, зато, может, по спортивной линии пойдет»…

Так вот, только тот, к кому с рождения относились с безусловной любовью, полностью уверен в себе. Если же этого не было – самооценка основательно хромает. И в этом случае я советую восполнить недостаток любви и уважения к себе. Уважайте и любите себя настолько, насколько хотели бы, чтобы вас любили и уважали другие.

Совершайте поступки, которые свойственны людям с высокой самооценкой, ломайте рефлекторную дугу. Не идите на компромиссы, держитесь, не соглашайтесь выполнять работу, которую считаете «не своей», не идите на должность, которую считаете недостойной себя. Запаситесь терпением, мужеством и верьте в себя. Зарплата – это всегда та сумма, на которую вы себя чувствуете. 

Это страшное слово «прокрастинация»… Почему люди откладывают дела?

— Большинство прокрастинаторов – это жесткие перфекционисты с высочайшим уровнем тревоги и страха. То есть они даже боятся приступить к чему-либо из страха, что не сделают это до конца или не сделают это блестяще.

Перфекционисты и отличники – это не те, кто делает на отлично все, за что ни возьмутся, а те, кто даже не берется за дело, если не уверен, что справится с ним на пять. Вот они и откладывают, а в острых случаях вообще ничего не делают…

Когда это мешает карьере и негативно сказывается на судьбе в целом – надо идти к психотерапевту.

Страх перед публичными выступлениями – это тоже часть проблемы низкой самооценки? Как его побороть?

— Такой страх перед выступлениями порождается страхом быть непонятым, неуверенностью в том, что тебя оценят, одобрят, услышат. В конечном счете – это страх проигрыша. И с ним-то и надо работать.

А вот бороться ни с чем как раз не надо. Сама постановка задачи – неверна. «Я боюсь, я нервничаю, но я поборю это, я справлюсь, я завоюю аудиторию»… И вот вы уже как будто на войне. Нет!

Надо выходить к людям с любовью, с интересом к ним, с желанием поделиться, что называется, с «открытым забралом». Это, кстати, приходит само, когда человек приводит к адеквату свою самооценку, начинает любить себя, «расслабляется по жизни».

Насколько справедливо разделение людей на интровертов и экстравертов? Правда ли, что это деоение в какой-то степени определяет то, в чем человек может состояться лучше всего?

— Не бывает стопроцентных интровертов и экстравертов. Вопрос в том, чего в вас больше – экстра или интро…  От этого процента и зависит, с чем человек больше приспособлен работать: с бумагами, механизмами или людьми. И вот такое деление более функционально. Точно выясните, к какому типу относитесь, и выбирать работу будет легче.

Люди часто себя неправильно понимают и оценивают. Например, испытывают потребность в общении, но из страха быть непонятыми замыкаются и считают себя интровертами (и работают на складе вместо того, чтобы сидеть на ресепшене)…

Правда ли, что для психологического комфорта каждому человеку необходимо периодически менять работу? Если да, то как часто?  И по каким внутренним сигналам можно понять, что пора уходить?

— Себя надо слушать. Если есть внутренняя потребность и ощущение, что вы засиделись на одном месте – меняйте работу, а если нет, зачем менять? Тут нет никаких рецептов и правил. Но, как известно, есть национальные традиции. В США принято менять работу раз в 5-7 лет и чаще, а в Японии — чем дольше на одном месте работаешь, тем больше почета.

Недавно встретил директора школы, в которой я работал 30 лет назад. Сейчас ему за 90, он в прекрасной форме, 63 года работает в школе, из них 40 лет — в своей нынешней должности. И это одна из самых знаменитых школ Москвы. И как вы понимаете, ему в ней очень даже психологически комфортно…

Есть ли психологические проблемы, которые больше присущи женщинам, чем мужчинам? Какие психологические препятствия на пути к успеху чаще всего встают перед ними? Как их преодолеть?

— Безусловно, женщины более эмоциональны. И возможно, это как-то влияет на их продвижение по карьерной лестнице. Но в целом тут я против гендерного деления. Думаю, не существует специально мужских и специально женских качеств, которые помогают или мешают деловому успеху.

snob.ru

Трансмембранный TNF-зависимый захват антител против TNF

MAb. 2017 май-июнь; 9 (4): 680–695.

, а, * , а, * , а , а , а , а , а , 0004 а , 0004 б , ## , a, ** , a , a , a , a, # , a , b , a и 4 a Arun Deora

a AbbVie Bioresearch Center, Вустер, Массачусетс, США

Subramanya Hegde

a AbbVie Bioresearch Center, Worcester, MA, USA

Jacqueline Lee

9000bVie , США

Chee-Ho Choi

a AbbVie Bioresearch Center, Worcester, MA, USA

Qing Chang

a AbbVie Bioresearch Center, Worcester, MA, USA

Cheryl Lee

Центр биологических исследований, Вустер, Массачусетс, США SA

Lucia Eaton

a AbbVie Bioresearch Center, Worcester, MA, USA

Hua Tang

b AbbVie Inc, North Chicago, IL, USA

Dongdong Wang

9000bVie 9000 Bioresearch Centre, 9000 Bioresearch Centre Вустер, Массачусетс, США

Дэвид Ли

a AbbVie Bioresearch Center, Вустер, Массачусетс, США

Mark Michalak

a AbbVie Bioresearch Center, Worcester, MA, USA

Medha

inson

0 Центр биологических исследований AbbVie, Вустер, Массачусетс, США

Qingfeng Tao

a Центр биологических исследований AbbVie, Вустер, Массачусетс, США

Nidhi Gaur

a AbbVie Центр биологических исследований Бодвие, США

Харди, США

Харди, США

a AbbVie Bioresearch Center, Вустер, Массачусетс, США

Shaun McLoughlin

b AbbVie Inc, North Chicago, IL, USA

Boris Labkovsky

a AbbVie Bioresearch Center, Вустер, Массачусетс, США

Tariq Ghayur

a AbbVie Bioresearch Center, Worcester, MA, USA

a AbbVie

, MA

, США

b AbbVie Inc, Северный Чикаго, Иллинойс, США

Subramanya Hegde [email protected], Основа иммунологии, Центр биологических исследований AbbVie, 381 Plantation Street, Worcester, MA 01605, USA

* Эти авторы внесли равный вклад в исследование.

** Текущий адрес: Mersana Therapeutics, 840 Memorial Drive, Кембридж, Массачусетс 02139, США.

# Текущий адрес: Berg LLC, 500 Old Connecticut Path, Building B, 3rd Floor, Framingham, MA 01701, США.

## Текущий адрес: BioAnalytix, Inc., 790 Memorial Drive, Кембридж, Массачусетс 02139, США.

Поступила 22 декабря 2016 г .; Пересмотрено 24 февраля 2017 г .; Принято 6 марта 2017 г.

Авторские права Опубликовано по лицензии Taylor & Francis Group, LLC Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution-NonCommercial-NoDerivatives License (http://creativecommons.org/licenses/by-nc). -nd / 4.0 /), который разрешает некоммерческое повторное использование, распространение и воспроизведение на любом носителе, при условии, что оригинальная работа должным образом процитирована, и не будет изменена, преобразована или дополнена каким-либо образом.Эта статья цитировалась в других статьях в PMC.

РЕФЕРАТ

TNF-α (TNF), провоспалительный цитокин синтезируется в виде белка 26 кДа, закрепляется в плазматической мембране как трансмембранный TNF (TmTNF) и подвергается протеолизу с помощью фермента, преобразующего TNF-α (TACE ) для высвобождения 15 кДа формы растворимого TNF (sTNF). TmTNF и sTNF взаимодействуют с 2 отдельными рецепторами, TNF-R1 (p55) и TNF-R2 (p75), чтобы опосредовать множественные биологические эффекты TNF, описанные на сегодняшний день. Некоторые биопрепараты против TNF, которые связываются с обеими формами TNF и блокируют их взаимодействия с рецепторами TNF, в настоящее время одобрены для лечения множества иммуноопосредованных заболеваний.В нескольких сообщениях предполагается, что связывание анти-TNF с TmTNF обеспечивает «обратный» сигнал снаружи внутрь, который также может способствовать эффективности анти-TNF. У некоторых пациентов, однако, развиваются реакции антител к лекарственным средствам против TNF (ADA или иммуногенность). Здесь мы биохимически демонстрируем, что TmTNF временно экспрессируется на поверхности стимулированных липополисахаридами первичных человеческих моноцитов, макрофагов и дендритных клеток (ДК), происходящих из моноцитов, и экспрессия TmTNF на поверхности клетки усиливается после обработки клеток TAPI-2. , ингибитор ТАСЕ.Важно отметить, что связывание анти-TNF с TmTNF на DC приводит к быстрой интернализации комплекса анти-TNF / TmTNF сначала в ранние эндосомы, а затем в лизосомы. Интернализованные антитела против TNF обрабатываются, и пептиды против TNF могут быть элюированы с поверхности DC. Наконец, пептиды столбнячного токсина, слитые с анти-TNF, презентируются DC, чтобы инициировать ответ пролиферации Т-клеток. В совокупности эти наблюдения могут предоставить новое понимание биологии TmTNF, механизма действия анти-TNF, биологии ответа ADA на анти-TNF и могут помочь в разработке следующего поколения анти-TNF.

КЛЮЧЕВЫЕ СЛОВА: Анти-лекарственные антитела (ADA), анти-TNF, клатрин, эндоцитоз, мембранный TNF, трансмембранный TNF, обратная передача сигналов TmTNF, столбнячный токсин

Аббревиатуры
TNF
фактор некроза
Растворимый TNF
mTNF
Мембранно-связанный TNF
TmTNF
Трансмембранный TNF
TNF-R1
TNF-рецептор 1
TNF-R2
TNF-200
AD2
анти-рецептор TNF-90
mAb
Моноклональное антитело
DCs
Дендритные клетки
TACE
TNF α-конвертирующий фермент
ICD
Внутрицитоплазматический домен
IBD
RI
Воспалительное заболевание кишечника Бычий сывороточный альбумин
ELISA
Иммуноферментный анализ
SDS-PAGE
9 0201 Электрофорез в полиакриламидном геле с додецилсульфатом натрия
PMSF
Фенилметилсульфонилфторид
FACS
Сортировка клеток с активацией флуоресценции
кДа
Килодальтон
Килодальтон
Фактор эксклюзии 9018 (TNF) — провоспалительный цитокин с различными биологическими функциями. 1,2 Было продемонстрировано, что активация Toll-подобных рецепторов в иммунных клетках играет роль в синтезе различных провоспалительных цитокинов, включая TNF. TNF принадлежит к семейству цитокинов типа II и первоначально экспрессируется как белок из 233 аминокислот, состоящий из N-концевого внутриклеточного домена (ICD) из 35 аминокислот (аа), консервативной последовательности из 21 аминокислот, которая охватывает плазматическую мембрану, и большой 177 аминокислотный С-концевой внеклеточный домен. 3 TNF синтезируется как протеин с массой ~ 25 кДа, и после посттрансляционной модификации 4 заякоряется в плазматической мембране в виде трансмембранного TNF (TmTNF).TmTNF протеолитически процессируется TNF-α-конвертирующим ферментом, TACE, между остатками 76Alanine и 77 Valine во внеклеточном домене с высвобождением 157 аминокислотных (~ 15 кДа) растворимых цитокинов TNF (sTNF). 3 Расщепление остаточных внутримембранных аминокислотных остатков гомологами сигнальных пептидных пептидаз SPPL2a и SPPL2b высвобождает ICD TNF, который, как предполагается, запускает экспрессию провоспалительного цитокина интерлейкина (IL) -12 в активированных дендритных клетках ( DC). 5,6 Высококонсервативный ICD TmTNF также вовлечен в явление, называемое «обратной» передачей сигналов, при котором закрепленная на мембране форма TNF трансдуцирует клеточные сигналы при связывании с антителами против TNF 7 или с их мембраносвязанными или растворимыми родственные рецепторы, такие как TNF-R1 и TNF-R2. 8 Было продемонстрировано, что TmTNF фосфорилируется в ICD по остаткам серина в консенсусной последовательности 2STES5 казеинкиназой 1, запускающей «обратную» передачу сигналов в клетках млекопитающих. 9

TNF продуцируется иммунными клетками, такими как моноциты / макрофаги, 10 DC, 11 T-клеток, 12 B-клеток, 13 NK-клеток 14 и нейтрофилов, 15 , а также как некоторые неиммунные клетки, такие как эндотелиальные клетки, 16 адипоцитов, 17 фибробластов 18 и остеокласты. 19 Разнообразные биологические функции TNF опосредуются связыванием и передачей сигналов через 2 рецептора клеточной поверхности, TNF-R1 и TNF-R2. Известно, что TNF-R1 конститутивно экспрессируется почти на всех типах клеток, 20 , в то время как TNF-R2 индуцибельно экспрессируется клетками миелоидного происхождения, периферическими Т-клетками, альвеолярными макрофагами и лимфоцитами. 21 Хотя в клеточных ответах на sTNF доминирует TNF-R1, сообщалось, что TmTNF сильно стимулирует TNF-R2. 22 Следовательно, функциональные результаты таких взаимодействий могут зависеть от множества факторов, таких как типы клеток, экспрессирующие TNF-R1 или TNF-R2, стадия клеточной дифференцировки, скорость синтеза про-TNF, посттрансляционная модификация и TACE- опосредованное расщепление TmTNF с образованием sTNF.Таким образом, разнообразие эффектов sTNF / TmTNF можно контролировать с помощью различной чувствительности рецепторов, что приводит к важным физиологическим результатам в виде местных или системных воспалительных реакций.

Независимо от точного понимания биологической и патологической роли двух форм TNF (sTNF и TmTNF), TNF является клинически подтвержденной мишенью. Терапевтические средства против TNF произвели революцию в лечении многих хронических воспалительных заболеваний, таких как ревматоидный артрит (РА), воспалительное заболевание кишечника (ВЗК), анкилозирующий спондилит и псориаз.Биопрепараты против TNF структурно подразделяются на 3 типа: (1) двухвалентные моноклональные антитела (mAb), например, инфликсимаб, голимумаб; (2) сконструированный гибрид TNF-R2-Fc, этанерцепт и (3) моновалентный Fab (без Fc и шарнирной области) mAb против TNF, ковалентно связанных с полиэтиленгликолем, цертолизумаб пегол. Хотя все эти антагонисты против TNF одинаково хорошо связываются и блокируют взаимодействия sTNF с 2 рецепторами TNF и, как известно, оказывают сильные клинические эффекты при РА, 23,24 не все проявляют одинаковую эффективность при некоторых заболеваниях, таких как болезнь Крона.Например, этанерцепт не показал эффективности при болезни Крона, 25 , тогда как инфликсимаб был эффективен при такой гранулематозной болезни. 26 Несмотря на свой успех в улучшении качества жизни пациентов, терапевтические средства против TNF могут вызывать у некоторых пациентов анти-лекарственные антитела (ADA), а ADA может влиять как на эффективность, так и на фармакокинетику. Новые данные свидетельствуют о том, что различия в клинических результатах лечения анти-TNF нельзя объяснить исключительно их способностью нейтрализовать растворимый TNF.Другие свойства анти-TNF, такие как взаимодействие с TmTNF и FcγR, также могут влиять на эффективность, потенциально ответы ADA и общие клинические исходы. Учитывая, что TmTNF экспрессируется на поверхности многих типов клеток, включая антигенпрезентирующие клетки, и обладает способностью индуцировать «обратный сигнал» в ответ на связывание антагонистом против TNF, мы предположили, что это взаимодействие каким-то образом подобно взаимодействию лиганд-рецептор, может вызывать интернализацию TmTNF-связанных анти-TNF в клетку и последующий процессинг для презентации антигена родственным Т-клеткам.И как таковой, это может быть механизмом, ведущим к развитию ответа ADA на биологический препарат.

Белок

TNF может присутствовать на поверхности клеток либо в виде 26 кДа TmTNF, либо в виде растворимого TNF 15 кДа, связанного с его рецепторами. Присутствие этих форм может зависеть от природы и продолжительности стимула, типа клеток, факторов окружающей среды и методов, используемых для обнаружения поверхностного TNF. В течение последних нескольких лет биология TmTNF изучалась биохимическими и функциональными методами.Эти методы включают временную и стабильную сверхэкспрессию мутантных форм дикого типа или TACE-устойчивых мутантных форм TNF полной длины 26 кДа, 1 флюоресцентно-активируемых клеточных сортировок (FACS), иммуноферментный анализ (ELISA), вестерн-блоттинг, иммунопреципитацию. совместное культивирование стимулированных нормальных клеток, клеточных линий или трансфектантов TNF и обработка клеток ингибиторами металлопротеаз, такими как BB1101 и TAPI-2, для блокирования процессинга и выделения TmTNF. 27,28

Здесь мы описываем биологические последствия взаимодействия анти-TNF-TmTNF.Мы демонстрируем кинетику экспрессии TmTNF на свежевыделенных человеческих моноцитах, макрофагах, происходящих из моноцитов, и DC с использованием подхода биотинилирования клеточной поверхности. Мы также демонстрируем, что связывание анти-TNF с TmTNF на DC приводит к быстрой интернализации комплекса анти-TNF-TmTNF, сначала проникая в эндосомы, а затем в лизосомы. Интернализованный анти-TNF процессируется, и его пептиды отображаются на поверхности DC, что вызывает ответ пролиферации Т-клеток. Эти наблюдения могут предоставить дополнительную информацию для понимания биологии TmTNF, потенциального механизма действия анти-TNF, ответов ADA и могут помочь в проектировании и разработке следующего поколения терапевтических средств против TNF.

Результаты

Кинетика экспрессии белка TmTNF в человеческих моноцитах, макрофагах, происходящих из моноцитов, и ДК

Для изучения биологии TmTNF в первичных моноцитах человека, а также в макрофагах и ДК, происходящих из моноцитов, мы сначала определили биохимически кинетику TNF. (TmTNF, цитозольный и sTNF) профили экспрессии после стимуляции липополисахаридом (LPS) у нескольких доноров. Кинетика экспрессии TNF была сходной у всех проанализированных доноров; однако абсолютные уровни выраженности варьировались.Представленные данные относятся к моноцитам, макрофагам, полученным из моноцитов, и DC, полученным от одного донора. Моноциты из мононуклеарных клеток периферической крови (PBMC) и макрофагов, происходящих из моноцитов, и DC стимулировали LPS в присутствии или в отсутствие TAPI-2 (подробности см. В разделе «Материалы и методы»). Для биохимического анализа TmTNF внеклеточные домены всех белков клеточной поверхности метили непроницаемым для клеток аналогом биотина. Биотинилированные белки клеточной поверхности обогащали на гранулах иммобилизованной стрептавидин-агарозы и подвергали иммуноблоттингу с использованием IgG против TNF.Среди белков клеточной поверхности и по сравнению с необработанными клетками активация LPS моноцитов и происходящих из моноцитов макрофагов () и DC () индуцировала устойчивую экспрессию анти-TNF-реактивного белка ~ 25 кДа. Отсутствие цитоплазматического белка GAPDH в биотинилированных белках клеточной поверхности, обогащенных преципитацией стрептавидина, демонстрирует, что цитозольные белки не были биотинилированы протоколом поверхностного биотинилирования (;). Результаты показывают, что в моноцитах, макрофагах, происходящих из моноцитов, и DC, TmTNF и цитозольный TNF могут быть обнаружены этими методами в течение периода до 6 часов после стимуляции LPS, и в течение этого времени растворимый TNF продолжает накапливаться в супернатанте клеточной культуры (; ).Кроме того, обработка моноцитов и макрофагов, происходящих из моноцитов, и DC с помощью TAPI-2, ингибитора TACE, усиливает обнаружение TmTNF на клеточной поверхности и снижает накопление sTNF в супернатанте (и). Мы неоднократно наблюдали, что, хотя макрофаги, происходящие из моноцитов, продуцируют обильные количества sTNF, низкие уровни TmTNF обнаруживаются в этих клетках в отсутствие обработки TAPI-2. Это наблюдение предполагает, что макрофаги могут эффективно обрабатывать TmTNF.

Кинетика экспрессии TNF в моноцитах и ​​макрофагах человека после обработки LPS.Моноциты CD14 + человека (A) или макрофаги, происходящие из моноцитов CD14 + человека (B) на 7 день, либо не обрабатывали, либо обрабатывали LPS в присутствии или в отсутствие ингибитора TACE, TAPI-2, в течение указанных периодов времени. Белки клеточной поверхности метили непроницаемым для клеток сульфо-NHS-SS-биотином. Биотинилированные поверхностные белки осаждали гранулами агарозы, конъюгированной со стрептавидином. Биотинилированные поверхности клеток и общие белки подвергали иммуноблоттингу с использованием IgG против TNF. Экспрессии белков Na, K-АТФазы и GAPDH использовали в качестве контроля общей загрузки белка и биотинилирования клеточной поверхности.Бесклеточные культуральные супернатанты моноцитов (C) и макрофагов (D), обработанных в (A) и (B), соответственно, анализировали на присутствие растворимого TNF (sTNF) с помощью ELISA.

Кинетика экспрессии TNF в дендритных клетках, полученных из моноцитов, после обработки LPS. ДК 5-го дня, происходящие из моноцитов CD14 + человека, либо не обрабатывали, либо обрабатывали LPS в отсутствие (A) или в присутствии (B) 20 мкМ ингибитора TACE, TAPI-2, в течение указанных периодов времени. Белки клеточной поверхности метили непроницаемым для клеток сульфо-NHS-SS-биотином.Биотинилированные поверхностные белки осаждали гранулами агарозы, конъюгированной со стрептавидином. Биотинилированные поверхности клеток и общие белки подвергали иммуноблоттингу с использованием IgG против TNF. Экспрессию белка кадгеринов и GAPDH использовали в качестве контроля загрузки общего белка и биотинилирования клеточной поверхности. Бесклеточные культуральные супернатанты DC, обработанные в (A) и (B) выше, анализировали на присутствие растворимого TNF (sTNF) (C) с помощью ELISA.

Кроме того, как и ожидалось, данные ясно демонстрируют, что обработка DC TAPI-2 увеличивала экспрессию ~ 25 белка TmTNF на поверхности клетки и одновременно снижала продукцию и, следовательно, накопление sTNF в супернатанте ().Интересно, что в присутствии LPS и TAPI-2 мы также обнаружили «расщепленный» TNF 15 кДа, биотинилированный непроницаемым для клеток аналогом биотина (). Эта «расщепленная» форма TNF 15 кДа не наблюдалась в поверхностных биотинилированных белках в отсутствие TAPI-2 (;). Это наблюдение предполагает, что, возможно, в присутствии TAPI-2, 1 или 2 мономера TNF заякоренного на мембране тримера TNF могут быть расщеплены TACE, но остаются прикрепленными к закрепленному на мембране нерасщепленному компоненту тримера TNF, и, следовательно, могут не расщепляться. выпущен в супернатант.В совокупности данные подтверждают, что в моноцитах, макрофагах, происходящих из моноцитов, и DCs, TmTNF временно закрепляется в мембране и расщепляется TACE с высвобождением sTNF в супернатанте культуры.

Связывание анти-TNF с TmTNF на DC приводит к интернализации комплекса анти-TNF / TmTNF.

Эндоцитоз включает интернализацию рецепторов трансмембранного белка и их внеклеточных лигандов в цитоплазматические везикулы, которые отщепляются от плазматической мембраны. Комплексы рецептор-лиганд (R-L) интернализуются с помощью множества механизмов. 29 Интернализация и внутриклеточный трафик — сложные процессы, которые требуют хорошо организованного набора сигнальных каскадов и реорганизации цитоскелета. 30 Интернализованные белки могут быть повторно циклированы на поверхность или доставлены во внутриклеточные везикулы, такие как эндосомы и лизосомы, где в присутствии гидролитических ферментов или низкого pH белки расщепляются, а их пептиды отображаются на поверхности клеток. 31 Поскольку TmTNF может служить рецептором, 32 и поскольку DC являются эффективными антигенпрезентирующими клетками, 31 мы предположили, что связывание анти-TNF с TmTNF может привести к интернализации и доставке анти-TNF к различным антигенам. отсек (и) обработки ДЦ.

Для оценки клеточного поглощения антител мы использовали конъюгированные с красителем pHrodo mAb против TNF, которые не флуоресцируют при нейтральном pH (вне клетки), но их флуоресценция резко возрастает по мере снижения pH от нейтрального до кислого во внутриклеточных везикулах, таких как эндосомы. и лизосомы. Кроме того, флуоресценция, излучаемая красным красителем pHrodo, прямо пропорциональна падению pH. 33 Чтобы определить, интернализуются ли комплексы анти-TNF / TmTNF, мы обрабатывали DC LPS в течение 2 часов для индукции TmTNF в отсутствие TAPI-2 с последующей инкубацией клеток с pH-чувствительными pHrodo-красителями, конъюгированными с антибиотиками. -TNF mAb.Интернализацию конъюгированного анти-TNF контролировали с помощью флуоресцентной микроскопии. Конъюгированные с pHrodo анти-TNF (окрашенные красным) можно было увидеть в пузырьковых структурах внутри клетки, окруженных плазматической мембраной (окрашенные зеленым с использованием анти-HLA класса I IgG) в LPS-обработанных DC (). Нам не удалось обнаружить такую ​​флуоресценцию в необработанных контрольных DC (данные не показаны). Кроме того, в отличие от LPS-обработанных DC, инкубированных с pHrodo-конъюгированным изотипическим контрольным человеческим IgG1, более 90% LPS-обработанных DCs, инкубированных с pHrodo-конъюгированным анти-TNF, были положительными по испусканию флуоресценции pHrodo по оценке FACS ().Наблюдаемая интенсивность излучения с длиной волны предполагала, что конъюгированный анти-TNF должен быть локализован в отсеках с низким pH (кислотных). Чтобы исключить какое-либо неспецифическое поглощение анти-TNF, мы оценили с помощью FACS поглощение pHrodo-конъюгированного изотипического контроля человеческого IgG1 или pHrodo-конъюгированного анти-TNF либо в необработанных контрольных DC, либо в DC, обработанных LPS в течение 2 часов, чтобы вызвать экспрессию TmTNF. Мы наблюдали значительно более высокое поглощение pHrodo-конъюгированных mAb против TNF в DC, обработанных LPS в течение 2 часов, по сравнению с поглощением pHrodo-конъюгированных изотипических контрольных IgG1 человека или mAb против TNF в контрольных, необработанных DC ().Эти данные демонстрируют опосредованную TmTNF интернализацию mAb против TNF в DC.

TmTNF-зависимый эндоцитоз анти-TNF в дендритных клетках. (A) ДК 5-го дня человека, происходящие из моноцитов CD14 +, обрабатывали LPS в течение 2 ч, инкубировали с pH-родо-конъюгированным антителом против TNF и контролировали клеточное поглощение меченого антитела против TNF. Плазматическую мембрану окрашивали с использованием IgG против MHC класса I (зеленый), ядро ​​(синий) и интернализованные pHrodo-anti-TNF (красный) визуализировали с использованием проточной цитометрии Amnis imaging.(B) Человеческие DC на 5 день обрабатывали LPS в течение 2 часов, и клетки инкубировали либо в присутствии pH-родо-конъюгированного согласованного изотипического контрольного IgG (гистограмма с красными точками), либо pH-родо-конъюгированного антитела против TNF (гистограмма с синим закрашиванием). Поглощение меченых антител клетками отслеживали в течение 4 ч с помощью проточной цитометрии. (C) Для измерения кинетики эндоцитоза анти-TNF в кислые компартменты в DC клетки либо не обрабатывали (без LPS), либо обрабатывали LPS в течение 2 часов. Клетки инкубировали либо с человеческими антителами IgG1-pHrodo, либо с антителами против TNF-pHrodo.Эндоцитоз интернализованных анти-TNF измеряли как увеличение интенсивности флуоресценции с помощью проточной цитометрии в течение до 4 часов.

Затем мы определили, связана ли TmTNF-опосредованная интернализация (эндоцитоз) анти-TNF с привлечением каких-либо адаптерных белков на ICD TmTNF. С этой целью экспрессию TmTNF индуцировали в 2 ч обработанных LPS DC и клетках, обработанных либо контролем изотипа человеческого IgG1, либо антителами против TNF в течение 5 минут при 37 ° C. Комплексы TmTNF / анти-TNF обогащали на аффинной колонке с белком A и агарозой и подвергали пептидному анализу с использованием жидкостной хроматографии-масс-спектрометрии (LC-MS) / MS.Нам не удалось обнаружить какие-либо пептиды TNF в DC, экспрессирующих TmTNF, инкубированных с изотипическим контрольным человеческим IgG1. Напротив, иммунные комплексы, обогащенные анти-TNF, выявляют присутствие пептидных последовательностей, соответствующих TNF, а также различных белков, которые, как известно, участвуют в рецептор-опосредованном эндоцитозе лигандов (миозин 1G, β-тубулин, миозин 1D, IQGAP1; данные не показан), вместе с пептидами из тяжелой цепи клатрина (). Чтобы проверить прямую ассоциацию тяжелой цепи клатрина с TmTNF, мы подвергли иммунные комплексы из указанного выше эксперимента иммуноблоттингу с использованием антител против TNF или против тяжелой цепи клатрина.Мы наблюдали тяжелую цепь клатрина, ассоциированную с TmTNF, из иммунных комплексов, очищенных от DC, обработанных LPS и анти-TNF, и не смогли обнаружить ни TmTNF, ни тяжелую цепь клатрина в LPS-обработанных DC, инкубированных с контрольным изотипом антитела IgG1 человека (). Кроме того, чтобы определить, зависит ли эндоцитоз TmTNF / анти-TNF от его ассоциации с клатрином, мы использовали Dyngo 4a, ингибитор динамина, который, как известно, ингибирует клатрин-опосредованный эндоцитоз различных комплексов рецептор-лиганд. 34,35 LPS-обработанные DC, экспрессирующие TmTNF, либо не обрабатывали, либо обрабатывали 5 мкМ Dyngo 4a, и эндоцитоз pHrodo-конъюгированных mAb против TNF контролировали с помощью FACS.Мы наблюдали значительно более высокое поглощение анти-TNF в DC в отсутствие Dyngo 4a, тогда как Dyngo 4a было достаточно для отмены интернализации TmTNF / анти-TNF (). Эти данные ясно демонстрируют, что в DC, экспрессирующих TmTNF, эндоцитоз комплекса TmTNF / анти-TNF зависел от клатрина.

Клатрин-зависимый эндоцитоз анти-TNF в дендритных клетках. (A) Идентификация анти-TNF / TmTNF-ассоциированных белков : ДК, полученные из моноцитов CD14 + человека, на 5-й день обрабатывали LPS в течение 2 часов и инкубировали либо с совпадающим по изотипу человеческим IgG1, либо с анти-TNF в течение 5 минут при 37 °. С.Пептидные последовательности, соответствующие TNF или тяжелой цепи клатрина из белков, иммунопреципитированных против TNF, идентифицировали с помощью LC-MS / MS. (B) Идентификация анти-TNF / TmTNF-ассоциированной тяжелой цепи клатрина : Иммунопреципитированные белки и полные клеточные экстракты из DC, обработанных в (A) выше, подвергали иммуноблоттингу с использованием антител против тяжелой цепи клатрина или против TNF. IP: Иммунопреципитация. (C) Влияние ингибитора клатрина на эндоцитоз анти-TNF : ДК, полученные из моноцитов CD14 + человека, на 5-й день обрабатывали LPS в течение 2 часов либо в отсутствие (среда), либо в присутствии 5 мкМ ингибитора клатрина, Dyngo 4a.Эндоцитоз интернализованных анти-TNF измеряли как увеличение интенсивности флуоресценции с помощью проточной цитометрии в течение до 4 часов.

Интернализованный комплекс TmTNF-анти-TNF подвергается везикулярному переносу, процессингу, и пептиды против TNF могут быть элюированы с клеточной поверхности DC.

Чтобы лучше понять внутриклеточную компартментализацию / перенос комплексов TmTNF / анти-TNF, мы выполнили Изучение конфокальной микроскопии с импульсной погоней (временной ход) с использованием гуманизированных mAb против TNF, конъюгированных с Alexa 488.Специфические внутриклеточные везикулы были идентифицированы путем окрашивания клеток либо анти-EEA1 (ранний эндосомный маркер), либо анти-LAMP1 (лизосомальный маркер). Эти исследования () продемонстрировали, что сразу после добавления (до 25 минут) mAb против TNF к обработанным LPS, экспрессирующим TmTNF DC через 2 часа анти-TNF (зеленая флуоресценция) мигрирует с поверхности клетки в везикулы, окрашенные анти-EEA1 (ранние эндосомы; красная флуоресценция), но не с отделениями, окрашенными анти-LAMP1 (лизосомы; красная флуоресценция). Однако со временем (35–45 минут) анти-TNF значительно совмещается с компартментом, окрашенным анти-LAMP1, но не с везикулами, окрашенными анти-EEA1 ().Примерно через 1 час сигнал анти-TNF не мог быть обнаружен ни на поверхности клетки, ни внутри клеток. Такие наблюдения подсказали нам, что TmTNF-опосредованные интернализованные анти-TNF могут не возвращаться обратно на клеточную поверхность и, по крайней мере, перемещаться через ранние эндосомы в лизосомы, где, возможно, они разрушаются и поэтому не могут быть обнаружены.

TmTNF-зависимый везикулярный транспорт гуманизированных анти-TNF и обнаружение пептидов анти-TNF на клеточной поверхности в дендритных клетках. (A) Компартментализация анти-TNF: ДК, полученные из моноцитов CD14 + человека, на 5-й день обрабатывали LPS в течение 2 часов, и клетки «пульсировали» на льду с использованием конъюгированных с Alexa 488 антител против TNF (0 мин, лед).Флуоресцентная метка на анти-TNF «гналась» в течение 1 ч при 37 ° C. Эндосомы и лизосомы окрашивали конъюгированными с Alexa 647 анти-EEA1 и анти-LAMP1, соответственно. Ядро окрашивали DAPI. Изображения были получены с помощью конфокальной микроскопии. (B) Идентификация пептидов против TNF, связанных с клеточной поверхностью: ДК, происходящие из моноцитов CD14 + человека, на 5 день обрабатывали LPS в течение 2 часов и инкубировали либо с mAb против TNF, либо с DVD-Ig, содержащим один домен против TNF для 6 ч. Пептиды, отображаемые на клеточной поверхности, элюировали в умеренно кислых условиях, и идентичность пептидов против TNF определяли с помощью LC-MS / MS.(C) Идентификация HLA-DR-ассоциированных пептидов против TNF: ДК, полученные из моноцитов CD14 + человека, на 5 день обрабатывали LPS в течение 2 часов и инкубировали с анти-TNF в течение до 8 часов. HLA-DR был иммунопреципитирован, и идентичность HLA-DR-ассоциированных пептидов против TNF была получена с использованием LC-MS / MS (подчеркнуто: линкерная пептидная последовательность DVD-Ig против TNF).

Чтобы определить судьбу интернализованных анти-TNF, мы стимулировали DC в течение 2 часов с помощью LPS, чтобы вызвать экспрессию TmTNF, с последующей инкубацией либо с гуманизированным mAb против TNF, либо с гуманизированным двойным вариабельным доменом (DVD) — Молекула Ig, содержащая домены против TNF, в течение 6 часов.Молекула DVD-Ig, формат четырехвалентного антитела с двойной специфичностью, содержит 2 вариабельных домена (VD) на каждом Fab, соединенных в тандеме линкером 36 , и является бивалентным для каждой указанной мишени. DVD-Ig, использованный в этом исследовании, содержал один набор связывающих доменов против TNF и второй набор VD, которые распознавали вторую мишень, анти-IL-17. 2 VD (анти-TNF и анти-17 на каждом Fab) этой молекулы DVD-Ig были связаны вместе линкером GS из 14 аминокислот. И гуманизированные mAb против TNF, и гуманизированные DVD-Ig против TNF имели одинаковую эффективность в отношении TNF ().DC, обработанные анти-TNF, промывали слабой кислотой для элюирования отображаемых на поверхности пептидов и подвергали ЖХ-МС / МС для идентификации пептидов. Анализ ЖХ-МС / МС идентифицировал пептиды гуманизированных молекул против TNF (). Эти данные подтверждают идею о том, что интернализованные биопрепараты против TNF деградируют и обрабатываются, возможно, в лизосомах, и их пептиды могут элюироваться с поверхности DC.

Таблица 1.

Использование различных антител против TNF в данном исследовании.

Профиль анти-TNF Профиль SEC (% мономера) Связывание с FACS Нейтрализация TNF (анализ L929) Поглощение клетками
9

0

9 904 + 0.06 нМ +
Анти-TNF-2 ** 94 + 0,05 нМ +
Анти-TNF-3 **

3 95422

0,01 нМ +
Анти-TNF-4 ** 96 + 0,015 нМ +
DVD-Ig 22 904 + 904 0,03 нМ +

Чтобы дополнительно установить, что пептиды, элюированные с поверхности гуманизированных анти-TNF mAb-обработанных ДК, были связаны с молекулами HLA-DR, мы обработали LPS-стимулированные DC, экспрессирующие TmTNF, гуманизированными антигенами. -TNF mAb, как указано выше, и белок HLA-DR подвергали иммунопреципитации, как описано в разделе «Материалы и методы».Связанные с HLA-DR пептиды подвергали анализу ЖХ-МС / МС. Анализ идентифицировал тот же пептид, который мы идентифицировали в нашем анализе элюирования поверхности, вместе с некоторыми дополнительными пептидами (). Интересно, что некоторые пептиды с клеточной поверхности обработанных DVD-Ig DC происходили из линкерной области с / без фланкирующих последовательностей, которые соответствовали аминокислотной последовательности VD в молекуле DVDIg (пептидные последовательности подчеркнуты). Взятые вместе наши данные демонстрируют, что гуманизированные антитела против TNF, интернализированные TmTNF-экспрессирующими DC, обрабатываются и загружаются в HLA-DR для презентации антигена.Однако следует отметить, что не все пептиды, представленные в контексте HLA-DR, являются иммуногенными, поскольку некоторые пептиды, производные от mAb, на самом деле могут быть толерогенными. 37

TmTNF-зависимое поглощение конъюгированных с TNF пептидов столбнячного токсина процессируется и представляется Т-клеткам с помощью DC. В ответ мы слили 2 пептида столбнячного токсина (ТТ)

38 на С-концевых тяжелых цепях гуманизированного антитела против TNF (слитый IgG против TNF-TT;).Добавление пептидов TT к гуманизированным mAb против TNF не влияло на их способность эффективно нейтрализовать sTNF в анализе апоптоза L929 (). Два h LPS-обработанных DC, экспрессирующих TmTNF, либо оставляли необработанными, либо инкубировали в присутствии рекомбинантных TT или слитых белков против TNF-TT (анти-TNF-S1 или анти-TNF-S2). Анализ пролиферации Т-клеток проводили путем инкубации клеток, обработанных антителом против TNF-TT, с аутологичными Т-клетками. Как и ожидалось, по сравнению с необработанными ДК, пролиферация Т-клеток значительно увеличивалась, когда они были совместно культивированы с рекомбинантными ТТ-импульсными ДК ().Кроме того, экспрессирующие TmTNF DC, которые были обработаны антителами против TNF-S1 или против TNF-S2, показали дальнейшее увеличение пролиферированных Т-клеток по сравнению с необработанными или обработанными TT DC (). Наблюдали пролиферацию как CD4 +, так и CD8 + Т-клеток вместе с продукцией IL-2 / интерферона γ (данные не показаны). Эти результаты демонстрируют зависимый от TmTNF клеточный перенос анти-TNF в протеолитические компартменты (например, лизосомы), их эффективный протеолиз и достаточное проявление пептидов на поверхности DC, чтобы инициировать иммунный ответ отзыва Т-клеток со стороны PBMC людей, которые были ранее подвергались воздействию ТТ и, следовательно, обладали Т-специфическими Т-клетками памяти.

TmTNF-зависимое поглощение гуманизированных mAb против TNF и выработка дендритными клетками ответа на вызов Т-клеток памяти. (A) Схема создания слитых IgG против TNF-TT : Последовательность пептидов столбнячного токсина (TT) (S1 или S2) сливали с С-концом тяжелых цепей антитела против TNF для получения антитела против TNF. -S1 или антитела против TNF-S2. (B) Тестирование активности слитых IgG против TNF-TT : эффективность родительских антител к TNF и слитых IgG против TT (анти-TNF-S1 и анти-TNF-S2) в отношении нейтрализации растворимого TNF была протестировано с использованием анализа L929.(C) Измерение отклика отзыва Т-клеток в ДК : ДК, полученные из моноцитов CD14 + человека, обрабатывали ЛПС в течение 2 ч и инкубировали либо со столбнячным токсином (антигеном ТТ), либо с антителом к ​​TNF-S1, либо с антителом к ​​TNF-S2. . DC культивировали совместно с CFSE-меченными аутологичными Т-клетками, и пролиферацию Т-клеток оценивали с помощью проточной цитометрии.

Обсуждение

Здесь мы описываем некоторые биологические последствия взаимодействия mAb против TNF / TmTNF. Мы впервые показываем, что взаимодействие mAb против TNF с TmTNF на DC приводит к быстрому эндоцитозу комплекса анти-TNF / TmTNF, что приводит к доставке в лизосомы и деградации анти-TNF.Пептиды из молекул анти-TNF могут элюироваться с поверхности DC и могут обрабатываться и представляться DC для инициирования иммунного (отзыва) Т-клеточного ответа. Эти наблюдения могут предоставить дополнительную информацию о биологии TmTNF, механизме действия анти-TNF, биологии антител к антагонистам против TNF (иммуногенность антагонистов против TNF), наблюдаемых у некоторых пациентов, и могут помочь в разработке схемы лечения. следующее поколение анти-TNF с большей эффективностью и пониженной (или нулевой) иммуногенностью.

Биология TNF сложна. TNF существует в растворимой и мембранной формах, и обе формы, как известно, взаимодействуют с 2 рецепторами, TNF-R1 и TNF-R2, каждый из которых имеет различные пути передачи сигналов и биологический исход. 39 Хотя 2 формы TNF могут взаимодействовать с обоими рецепторами, считается, что TNFR1 и TNFR2 могут предпочтительно взаимодействовать с растворимым TNF и мембранным TNF соответственно. 22 Биология TNF и, в частности, взаимодействия анти-TNF / мембранного TNF дополнительно осложняются тем фактом, что мембранная форма TNF также может существовать в 2 формах, либо как закрепленный на мембране трансмембранный TNF (TmTNF; ~ 25 кДа) или в виде расщепленного ТАСЕ растворимого TNF, связанного с его родственными рецепторами на клеточной поверхности 40 (mTNF; 15 кДа).MAb и этанерцепт (Enbrel®) могут связывать TmTNF, 41 , но некоторые mAb и этанерцепт могут не связываться с mTNF. Кроме того, биологические последствия взаимодействия анти-TNF / TmTNF и анти-TNF / mTNF могут быть совершенно разными. В первом случае биологические последствия являются результатом передачи сигналов через TmTNF («обратная» передача сигналов), а во втором случае последствия могут быть результатом передачи сигналов через рецепторы TNF (R1 или R2), с которыми связан mTNF. Судьба анти-TNF, связанного либо с TmTNF, либо с mTNF, затем будет определяться тем, будут ли и как комплексы анти-TNF / TmTNF и анти-TNF / mTNF / TNFR1 или TNFR2 поглощаются клетками (эндоцитоз) и их последующий внутриклеточный пути незаконного оборота — рециркуляция или деградация (обсуждаются ниже).

Чтобы изучить последствия взаимодействий анти-TNF с TmTNF, мы применили систематический подход, чтобы сначала определить кинетику экспрессии TmTNF в свежевыделенных человеческих моноцитах, макрофагах, происходящих из моноцитов, и DC. Используя метод поверхностного биотинилирования, только TmTNF был обнаружен на ранней стадии после стимуляции LPS (2-6 часов после стимуляции) (в отсутствие TAPI-2), но mTNF обнаружить не удалось. Однако, используя подход поверхностного биотинилирования, мы обнаружили mTNF на моноцитах, обработанных LPS в течение 24 часов (данные не показаны).Присутствие 15 кДа TACE-расщепленной формы mTNF было обнаружено на поверхности DC, но только в присутствии TAPI 2, и возможные причины этого обсуждаются выше (раздел «Результаты»). Поэтому, чтобы изучить последствия взаимодействия mAb против TNF с TmTNF, мы провели исследования, как описано здесь, с использованием 2–4 ч обработанных LPS DC в отсутствие TAPI-2, момент времени, когда только TmTNF экспрессировался на поверхность ДК.

Для связи с внешней средой и поддержания клеточного и тканевого гомеостаза клетки используют несколько путей эндоцитоза для передачи внешних сигналов внутрь клетки посредством взаимодействий рецептор-лиганд (R-L).Такие RL-взаимодействия вызывают кластеризацию рецепторов на клеточной мембране, что может зависеть от плотности рецептора, концентрации лиганда, свойств связывания лиганда, и может потребоваться определенное количество времени на поверхности для сборки механизмов интернализации (эндоцитоза), например, покрытых клатрином образование ямок / пузырьков, реорганизация цитоскелета и рекрутирование адаптерных белков. 30 Эти начальные события во взаимодействиях R-L определяют судьбу комплексов R-L внутри клеток, т.е.е., будет ли интернализованный лиганд повторно возвращаться на поверхность или разлагаться в лизосомах. 30 Данные, представленные и ясно демонстрирующие, что комплекс анти-TNF / TmTNF быстро эндоцитозируется. Интернализация анти-TNF сильно зависит от экспрессии TmTNF, поскольку не наблюдалось неспецифического поглощения любого изотипического контрольного человеческого IgG1 стимулированными LPS или необработанными контрольными DC (). Контрольными необработанными DC наблюдали только минимальное поглощение анти-TNF.В настоящее время мы не знаем, экспрессировали ли эти не стимулированные ЛПС DC, которые культивировались в течение 5 дней в присутствии фактора, стимулирующего колонии гранулоцитов-макрофагов (GM-CSF) и IL-4, незначительные уровни белка TmTNF, которые могли не может быть обнаружен с помощью метода биотинилирования клеточной поверхности, который мы использовали. Однако TNF, расщепленный ТАСЕ, не мог быть обнаружен в культуральных супернатантах таких клеток с помощью ELISA.

Поскольку эндоцитоз связан с изменениями цитоскелета и привлечением цитоскелетных / адаптерных белков, мы попытались определить, можем ли мы идентифицировать с помощью mAb против TNF любые TmTNF-ассоциированные белки в заданный момент времени.Как и ожидалось, мы идентифицировали не только несколько пептидов TNF, но также пептиды, представляющие тяжелую цепь клатрина и несколько других структурных / цитоскелетных белков, которые могут быть связаны с механизмом эндоцитоза анти-TNF / TmTNF. 29 Поскольку мы обнаружили пептиды тяжелой цепи клатрина в преципитации анти-TNF экспрессирующих TmTNF ДК, мы хотели определить, будет ли Dyngo 4a, соединение, ингибирующее клатрин-опосредованный эндоцитоз, блокировать опосредованную TmTNF интернализацию анти-TNF. mAb.Действительно, обработка Dyngo 4a LPS-стимулированных TmTNF-экспрессирующих DC почти полностью ингибировала TmTNF-опосредованный эндоцитоз mAb против TNF. В совокупности наши результаты демонстрируют, что интернализация анти-TNF является активным, TmTNF-зависимым процессом.

Интернализованные комплексы R-L после переноса через различные внутриклеточные компартменты могут либо повторно возвращаться на поверхность, либо подвергаться деградации, в частности, в лизосомах. 42 Судьба интернализованных комплексов, в частности комплексов антитело / рецептор, определяется множеством факторов, включая структурные особенности антитела, биологию рецептора-мишени и характер взаимодействия антитело / рецептор.Хорошо известно, что большая часть циркулирующих антител поглощается клетками неспецифически и после взаимодействия с неонатальным Fc-рецептором (FcRn) при низком pH в эндосомах снова возвращается в кровоток. Однако, если молекула антитела не может продуктивно взаимодействовать с FcRn, молекула антитела следует по пути деградации в лизосомах. 43 В случае антител, которые интернализуются при связывании с мишенями на их клеточной поверхности, судьба молекулы антитела определяется биологией рецептора-мишени и природой взаимодействия антитело / мишень. 44 Например, некоторые рецепторы эффективно рециклируют, и, если антитело остается связанным с мишенью при низком pH в эндосомах, оно может повторно возвращаться на поверхность вместе с рецептором. 45 В других случаях определенные рецепторы после интернализации доставляют свой груз (включая антитела) непосредственно в лизосомы для деградации. 31 Чтобы понять, следует ли TmTNF-опосредованные интернализованные mAb против TNF по пути рециклирования или деградации, мы сначала изучили кинетику внутриклеточного движения гуманизированных mAb против TNF, конъюгированных с Alexa-488, с помощью конфокальной микроскопии.В этих экспериментальных условиях (описанных в разделе «Материалы и методы») мы наблюдали, что после первоначального кластеризации гуманизированных mAb против TNF на поверхности клетки они интернализуются в ранние эндосомы (по оценке окрашивания EEA 1), быстро переходят в лизосомы. (по оценке по окрашиванию LAMP 1) и затем не может быть обнаружен. Эти наблюдения предполагают, что TmTNF-опосредованные интернализованные mAb против TNF могут не повторять цикл, а скорее быстро доставляются в лизосомы, где они разрушаются.Эти свойства взаимодействий антитело-мишень (то есть интернализация, быстрый переход к и деградация антитела в лизосомах) являются желательными характеристиками для терапевтических средств конъюгата антитело-лекарственное средство (ADC), и поэтому наши данные предполагают, что ADC против TNF может формируют основу для следующего поколения терапевтических средств против TNF с повышенной эффективностью и пониженной иммуногенностью.

Хорошо известно, что пептиды белков, деградированных в различных внутриклеточных компартментах, могут быть представлены на поверхности клетки в контексте антигенпрезентирующих молекул (т.е.е., HLA у людей и MHC у мышей). Поэтому мы использовали метод элюции пептидов клеточной поверхности в умеренно кислых условиях 40 , чтобы определить, можем ли мы обнаружить гуманизированные пептиды, производные от TNF, с поверхности DC. Как описано выше (разделы «Материалы и методы» и «Результаты»), мы смогли идентифицировать пептиды из мягких кислотных элюатов с поверхности DC, которые совпадали с последовательностями нашей гуманизированной молекулы против TNF, в частности, специфические пептиды из линкерной области гуманизированного DVD-Ig G4S. .Поскольку линкер G4S считается «инертной» неиммуногенной последовательностью и обычно используется в качестве линкерного пептида при создании би- и мультиспецифических биопрепаратов и других слитых белков, необходимы дальнейшие исследования, чтобы определить, является ли высокая частота процессинга Пептиды, производные от G4S, обнаруженные в наших экспериментах, отражают свойство этой последовательности, контекст, в котором размещен этот линкер, или некоторые специфические свойства внутриклеточного трафика TmTNF. В настоящее время мы не знаем, являются ли эти пептиды, содержащие G4S-последовательность, или любые другие пептиды, производные от TNF, иммуногенными.

DC — это профессиональные клетки, представляющие и обрабатывающие антиген. Хорошо известно, что нацеливание на специфические рецепторы на DC с помощью антитела, с которым слиты специфические антигенные пептиды, может инициировать специфические иммунные ответы на слитые пептиды. 31,46 Чтобы определить, приводит ли TmTNF-опосредованная интернализация и протеолитический процессинг анти-TNF к презентации слитых пептидов DC для инициирования специфического Т-клеточного (отзыва) ответа, мы слили известные иммуногенные пептиды, производные от ТТ, с гуманизированными пептидами. молекула против TNF.Слитые с ТТ-пептидом гуманизированные mAb против TNF сохраняли свою функциональную активность. При совместном культивировании с ДК, обработанными пептидом ТТ, слитым гуманизированным анти-TNF, аутологичные Т-клетки (от предварительно отобранных доноров), которые отвечают на пептиды ТТ, индуцируют пролиферацию Т-клеток (ответная реакция). Эти данные демонстрируют, что TmTNF-опосредованные интернализованные mAb против TNF протеолитически процессируются, и слитые пептиды TT могут продуктивно презентоваться DC Т-клеткам. Наши данные могут иметь значение для понимания того, почему у некоторых пациентов, получавших антагонисты против TNF, развивается ответ антител против лекарств (ADA).Ответ ADA определяется множеством факторов. 47 Хотя процессинг и презентация антигена являются критическим требованием для инициирования иммунного ответа, не все пептиды, представленные антигенпрезентирующими клетками, являются иммуногенными или могут инициировать иммунный ответ. Фактически, некоторые пептиды, производные от mAb, могут быть толерогенными. 37 Данные, представленные в этом исследовании, показывают, что комплексы анти-TNF / TmTNF быстро интернализуются и что эндоцитированный анти-TNF быстро доставляется в лизосомы, процессинги и пептиды против TNF, представленные DC, предполагают, что судьба биологической терапии может быть определено целевой биологией, в данном случае TmTNF.Наши данные предполагают, что TmTNF может обладать внутренними характеристиками, которые увеличивают шансы развития ADA. Следовательно, скорость синтеза TNF, уровни экспрессии TmTNF и типы клеток, образующие TmTNF, могут быть критическими факторами, определяющими уровень и интенсивность развития ADA при воспалительных условиях, при которых доступны костимулирующие сигналы.

Представленные здесь данные относительно TmTNF-зависимой интернализации, внутриклеточного трафика и, в конечном итоге, деградации mAb против TNF могут иметь значение для дальнейшего понимания механизма действия терапевтических агентов против TNF.Было предложено несколько потенциальных механизмов, объясняющих замечательные профили эффективности и безопасности анти-TNF. Эти механизмы включают: 1) блокирование взаимодействий как sTNF, так и TmTNF с их рецепторами, R1 и R2; 48 2) устранение мембранного TNF (как sTNF, связанного с его рецепторами, так и закрепленного на мембране TmTNF), экспрессирующих Т-клетки, посредством антителозависимой клеточно-опосредованной цитотоксичности или комплемент-зависимой цитотоксичности через Fc-эффекторные функции; 49 3) образование регуляторных макрофагов и регуляторных Т (T reg ) клеток при взаимодействии с mTNF. 50,51 В дополнение к этим механизмам наши данные предполагают дополнительный механизм, который также может играть роль в определении общей эффективности молекул анти-TNF, т.е.быстрая интернализация и деградация TmTNF. Интернализация и деградация этого комплекса может иметь несколько последствий. Во-первых, снижение доступности TmTNF для расщепления с помощью TACE, тем самым уменьшая высвобождение sTNF. Во-вторых, отсутствие расщепления TACE из-за интернализации TmTNF может предотвратить дальнейшее расщепление трансмембранного домена TmTNF с помощью SPPL2a / SPPL2b и, таким образом, образование ICD, которое, как предполагается, индуцирует продукцию IL-12. 5 В-третьих, снижение доступности TmTNF может снизить потенциальные провоспалительные сигналы через R2 или R1. В-четвертых, интернализация рецептора (эндоцитоз) и внутриклеточная передача сигналов могут быть связаны событиями. 30 В этом отношении мы наблюдали, что взаимодействие mAb против TNF с TmTNF на DC генерирует «обратный» сигнал, который может модулировать продукцию дополнительных провоспалительных медиаторов, включая продукцию TNF, что предполагает наличие петли отрицательной обратной связи (данные не показано). Продолжаются исследования для дальнейшего понимания взаимодействия / взаимосвязи между интернализацией комплекса анти-TNF / TmTNF и «обратными» сигнальными событиями, и если взаимодействие TmTNF с TNF R1 / R2 на клеточной поверхности также приводит к интернализации TmTNF и «обратному» сигналу.Ответы на эти вопросы улучшат наше понимание биологии TmTNF, и в настоящее время проводятся эксперименты, чтобы ответить на эти вопросы.

Как подытожено, в этом исследовании мы продемонстрировали, что молекулы анти-TNF активно интернализуются при связывании с TmTNF на полученных из моноцитов ДК и быстро проникают в лизосомы, где они разрушаются. Пептиды против TNF могут элюироваться с поверхности DC и представляться Т-клеткам, чтобы инициировать ответную реакцию. Хотя не все отображаемые пептиды являются иммуногенными, представленные здесь наблюдения могут предоставить дополнительную информацию о биологии TmTNF, механизме действия анти-TNF, биологии антител к антагонистам TNF (иммуногенность антагонистов TNF), наблюдаемых у некоторых пациентов, и может помочь в разработке следующего поколения анти-TNF-препаратов с большей эффективностью и пониженной (или отсутствующей) иммуногенностью, таких как конъюгаты анти-TNF-лекарств.

Схематический обзор судьбы связанного с TmTNF анти-TNF. Связывание анти-TNF с экспрессируемым на клеточной поверхности TmTNF (1) приводит к трансдукции внутриклеточного «обратного» сигнала (2) и образованию ямки, покрытой клатрином (3), что приводит к эндоцитозу комплекса в эндосомы (4) с последующей доставкой. комплекса с фаголизосомным компартментом (5), где протеолитически обработанные анти-TNF пептиды загружаются на HLA-DR и впоследствии отображаются как HLA-DR-ассоциированные пептиды на поверхности клетки (6).

Материалы и методы

Проверенные антитела против TNF

перечисляет антитела против TNF, протестированные в данном исследовании. Эти антитела (полностью человеческий или гуманизированный изотип IgG1) экспрессировали в клетках 293 эмбриональной почки человека (HEK) посредством временных трансфекций и очищали с помощью аффинной хроматографии с протеином-A в AbbVie. Биофизические характеристики очищенных антител анализировали с помощью эксклюзионной хроматографии (SEC), и было обнаружено, что все перечисленные антитела содержат мономер более 94%.Было обнаружено, что антитела обладают почти схожей суб-нМ аффинностью по способности нейтрализовать растворимый TNF, как было оценено с использованием анализа L929 52 , и клеточному поглощению mAb, конъюгированных с pHRodo, по оценке с помощью FACS. Также тестировали молекулу Ig с двойным вариабельным доменом (DVD-Ig), содержащую 2 вариабельных домена, связывающих TNF, и 2 вариабельных домена, связывающих IL17, и, следовательно, бивалентные по TNF, с эффективностью, аналогичной упомянутым выше mAb против TNF. Описание формата DVD-Ig подробно описано в другом месте. 36

Выделение моноцитов и их дифференцировка в макрофаги и дендритные клетки

PBMC были выделены от здоровых доноров путем центрифугирования в градиенте плотности над Ficoll-Paque 53 (GE Healthcare). Моноциты выделяли из PBMC путем положительной селекции с использованием микрогранул CD14 и магнитного сепаратора клеток в соответствии с инструкциями производителя (MACS, Miltenyi Biotec). Чистота выделенных моноцитов была выше 98%, как определено проточной цитометрией.Моноциты культивировали в среде для роста клеток (среда RPMI1640 с добавлением 10% инактивированной нагреванием фетальной бычьей сыворотки (FBS), 2 мМ L-глутамина, 100 мкг / мл пенициллина и стрептомицина) при плотности 1 × 10 6 клеток / мл при 37 ° C в увлажненном инкубаторе с 5% CO 2 . Макрофаги были получены путем культивирования 1 × 10 6 / мл моноцитов CD14 + в среде для роста клеток, содержащей 100 нг / мл рекомбинантного человеческого GM-CSF (AbbVie) и 2% инактивированной нагреванием сыворотки крови человека AB (Invitrogen) в течение 7 дней 54 , 55 и оказались больше по размеру по сравнению с моноцитами и были прочно прикреплены к сосуду для культуры ткани.ДК были получены путем культивирования 1 × 10 6 клеток / мл моноцитов CD14 + в среде для роста клеток, содержащей 100 нг / мл рекомбинантного человеческого GM-CSF (AbbVie) и 5 ​​нг / мл человеческого IL-4 (R&D Systems) в течение 5 дней. d. Для индукции TNF моноциты, макрофаги и DC стимулировали указанными концентрациями LPS ( E. coli и S. typhimurium , Sigma) в течение указанных периодов времени либо в присутствии, либо в отсутствие 20 мкМ TAPI- 2 (Sigma), мощный ингибитор матриксных металлопротеиназ, включая ТАСЕ. 27

Биотинилирование клеточной поверхности

Биотинилирование белков клеточной поверхности выполняли, как описано. 56 Вкратце, после указанных обработок клетки (3 × 10 6 ) дважды промывали ледяным PBS-CM (фосфатно-солевым буферным раствором (PBS), содержащим 1 мМ CaCl 2 и 1 мМ MgCl 2 ). Белки клеточной поверхности дважды дериватизировали с использованием 1 мг / мл непроницаемого для клеток EZ-Link-Sulfo-NHS-SS-биотина (Thermo Fisher Scientific) в PBS-CM на льду в течение 30 минут, защищенном от света, при легком перемешивании.Избыток биотина гасили, инкубируя клетки в течение 10 мин на льду в 50 мМ NH 4 Cl в PBS-CM. Клетки дважды промывали PBS-CM и общие белки экстрагировали в 150 мкл лизирующего буфера (50 мМ Tris-HCl, pH 8, 150 мМ NaCl, 1% н-октил-β-D-глюкозид, 1% Triton X-100, смесь ингибиторов протеазы и 1 мМ фенилметилсульфонилфторид (PMSF)) на льду в течение 45 минут и центрифугирование при 14000 xg в течение 10 минут при 4 ° C. Осветленный супернатант переносили в свежую микроцентрифужную пробирку на льду и оценивали общее количество белков с помощью реагента для анализа белков BCA (Thermo Fisher Scientific).Для обогащения биотинилированных белков клеточной поверхности 25–75 мкг общих белков в 500 мкл лизирующего буфера постоянно перемешивали при 4 ° C в течение ночи с 50 мкл стрептавидин-конъюгированных агарозных шариков (Thermo Fisher Scientific). Гранулы агарозы собирали центрифугированием при 2500 g и последовательно промывали дважды (15 мин между каждой промывкой), суспендируя в 1 мл ледяного буфера для лизиса, дважды (15 минут между каждой промывкой) в 1 мл ледяного 500 мМ NaCl и один раз в 1 мл 50 мМ трис-HCl, pH 8. Связанные стрептавидин-агарозой, биотинилированные белки клеточной поверхности вместе с 5-15 мкг общих белков в отдельной пробирке суспендировали в буфере для образцов SDS-PAGE, содержащем 62.5 мМ трис-HCl pH 6,8, 2% SDS, 4 М мочевина, 5% β-меркаптоэтанол, содержащий 10% глицерина. Белки разделяли на 4-20% Novex Tris-Glycine SDS-PAGE (Invitrogen) с использованием 1X гелевого рабочего буфера (Invitrogen) и переносили на нитроцеллюлозную мембрану 0,2 мкм (Bio-Rad) на 1 час с использованием 1X гелевого буфера для переноса (Invitrogen). ). Нитроцеллюлозную мембрану инкубировали в 5% обезжиренном сухом молоке в TBS-T (25 мМ Tris-HCl, 150 мМ NaCl, pH 7,5, содержащий 0,2% Tween-20) в течение 30 минут при комнатной температуре при осторожном перемешивании, промывали один раз. в TBS-T в течение 5 минут при комнатной температуре и инкубировали в течение ночи при осторожном перемешивании при 4 ° C с указанными первичными антителами (анти-TNF (BAF210, Lot ST2813011)) от R&D Systems; анти-GAPDH (2118, лот 8), анти-пан-кадгерин (4073, лот 1) и анти-Na, К-АТФаза (3010, лот 4) от Cell Signaling Technology).Мембрану дважды промывали TBS-T по 15 минут при энергичном перемешивании при комнатной температуре и инкубировали с соответствующим вторичным IgG, конъюгированным с пероксидазой хрена (HRP) (NIF824, Lot 9564802 и NIF825, Lot 6000560 от GE Healthcare) в 5% не -жирное сухое молоко в TBS-T в течение 45 мин при комнатной температуре при легком взбалтывании. Мембрану промывали, как указано выше, и подвергали анализу с помощью систем вестерн-блоттинга ECL или ECL Prime (GE Healthcare).

Анализы интернализации антител

Чтобы определить, интернализуются ли молекулы анти-TNF, связанные с TmTNF, в определенные внутриклеточные компартменты, мы провели серию экспериментов с использованием либо pHrodo-, либо Alexa 488-конъюгированных антител против TNF.Антитела, конъюгированные с красителем pHrodo, не являются флуоресцентными вне клетки, но их флуоресценция резко возрастает при снижении pH с нейтрального до кислого, как во внутриклеточных везикулах, таких как эндосомы и лизосомы, что делает такие красители идеальными инструментами для изучения эндоцитоза антител, конъюгированных с pHrodo. 57 Поскольку pHrodo-конъюгированные зонды показывают pH-зависимую активацию флуоресценции, 33 конъюгация антител против TNF с использованием красителя pHrodo red или Alexa 488 была выполнена в соответствии с протоколом производителя (Invitrogen).Экспрессию TmTNF на клеточной поверхности индуцировали обработкой DC в течение 2 часов LPS при 37 ° C, и клетки тщательно промывали, используя ледяную среду для выращивания, для удаления растворимого TNF, образующегося в супернатантах. Клетки инкубировали на льду в ледяной среде с добавлением 2% сыворотки AB человека в течение 15 мин для предотвращения переработки TmTNF в растворимый TNF и для блокирования рецепторов Fc на поверхности клеток. Клетки центрифугировали в условиях холода и дополнительно инкубировали на льду в течение 1 ч либо с ледяным pH-родо-конъюгированным изотипом контрольным антителом, либо с pH-родо-конъюгированным антителом против TNF в 2% сыворотке AB человека для специфической мечения TmTNF на поверхности клеток и предотвращения его появления. клеточное поглощение.Клетки дважды промывали ледяной средой для роста клеток для удаления несвязавшихся антител и переносили при 37 ° C в среду для выращивания, содержащую 2% сыворотки AB человека, на срок до 4 ч для определения кинетики накопления pHrodo во внутриклеточных кислых компартментах. Чтобы наблюдать отдельные внутриклеточные везикулы на плазматической мембране, клетки окрашивали конъюгированными с Alexa 488 антителами против MHC класса I (Biolegend). Накопленную флуоресценцию регистрировали либо с помощью проточной цитометрии (BD Fortessa), либо с помощью флуоресцентной микроскопии (проточные цитометры Amnis Imaging, EMD Millipore).

Для точного определения внутриклеточного транспорта связанного с TmTNF антитела против TNF либо к ранней эндосоме, либо к лизосоме, мы выполнили иммуноцитохимию, инкубируя DC, обработанные 1 мкг / мл LPS, в течение 2 часов для индукции экспрессии TmTNF. Клетки промывали и инкубировали на льду в течение 1 ч с анти-TNF IgG, конъюгированным с Alexa 488, в ледяной среде для роста клеток с добавлением 2% сыворотки АВ человека для блокирования рецепторов Fc на поверхности клеток и для специфической метки TmTNF на поверхности клеток и ограничения его клеточного поглощение.После промывки клеток для удаления избытка антител клетки переносили при 37 ° C на срок до 1 часа, чтобы непосредственно визуализировать перенос и клеточное распределение меченых антител против TNF в различные моменты времени. Клетки фиксировали при комнатной температуре с использованием 4% параформальдегида в течение 15 минут и подвергали проницаемости (PBS, содержащий 0,3% Triton X-100 и 10% ослиную сыворотку) в течение 30 минут при комнатной температуре. Ранние эндосомы или лизосомы окрашивали с использованием кроличьих антител против EEA1 (3288, Lot 7 от Cell Signaling Technology; 1: 200) или кроличьих антител против LAMP1 (9091, Lot 4 от Cell Signaling Technology; 1: 200), соответственно, в антителе. буфер для разведения (PBS, содержащий 0.1% Triton X-100, 1% BSA и 5% ослиная сыворотка). Клетки дополнительно окрашивали в течение 45 минут при комнатной температуре с использованием конъюгированного с Alexa 647 антикроличьего IgG (711–605–152, лот 110488 от Jackson ImmunoResearch; 1: 600 в буфере для разведения антител). Ядро окрашивали Nuce blue или DAPI (Invitrogen), а изображения получали с помощью конфокальной микроскопии (Laica TCS SP5).

Идентификация TmTNF-ассоциированных белков

Для идентификации TmTNF-ассоциированных белков DC (10 × 10 6 ) обрабатывали LPS в течение 2 часов при 37 ° C для индукции экспрессии TmTNF на клеточной поверхности.Клетки промывали и инкубировали в течение 10 мин в ростовой среде, содержащей 5% инактивированной нагреванием сыворотки человеческого АВ, с последующим добавлением либо человеческого IgG1 (15 мкг / мл), либо антител против TNF (15 мкг / мл) при 37 ° C для указанный период времени. Клетки дважды промывали ледяным PBS и общий белок экстрагировали с использованием буфера для лизиса клеток (50 мМ Tris-HCl, pH 8, 150 мМ NaCl, 1% н-октил-β-D-глюкозид, 1% Triton X-100, коктейль ингибиторов протеазы и 1 мМ PMSF) на льду в течение 45 мин. Образцы центрифугировали при 14000 x g в течение 10 минут при 4 ° C и осветленный супернатант переносили в свежую микроцентрифужную пробирку на льду.Для обогащения иммунных комплексов общие белки в 0,5 мл буфера для лизиса перемешивали конец за концом в течение 1 ч при 4 ° C, добавляя 50 мкл бусинок агарозы, конъюгированных с протеином А (Cell Signaling Technologies). Гранулы агарозы собирали центрифугированием при 2500 x g и последовательно промывали дважды (по 15 минут каждый) путем суспендирования в 1 мл ледяного буфера для лизиса и дважды (по 15 минут каждый) в 1 мл ледяного PBS. Белки элюировали из шариков, используя 100 мМ глицин-HCl, pH 2,8.

Успешность аффинно очищенного TmTNF была подтверждена вестерн-иммуноблоттингом с использованием антител против TNF (R&D systems; BAF210).Оставшиеся образцы подвергали секвенированию с высоким разрешением масс-спектрометрии (ЖХ-МС / МС) для идентификации белков, связанных с TmTNF. 30 мкл элюатов иммунопреципитации объединяли с 10 мкл 4х невосстанавливающего буфера для образцов LDS-PAGE и нагревали при 80 ° C в течение 10 минут перед нанесением на 1,5 мм градиентные гели Bis-Tris 4–12% (Invitrogen). Гель-электрофорез проводили с использованием невосстанавливающего рабочего буфера MES в течение одного часа с последующим окрашиванием в Sypro Ruby. Используя трансиллюминатор Safe Imager ™ 2.0 (Invitrogen, Carlsbad, CA) для визуализации окрашивания белков, каждую полосу образца разрезали на 48 равных частей с помощью чистого скальпеля и сегменты добавляли по столбцам к 96-луночному полипропилену с коническим дном. пластина.Планшеты помещали на держатель, поддерживаемый при 50 ° C на протяжении всего процесса протеолиза в геле. Кусочки геля сначала промывали и обесцвечивали, добавляя 50 мкл 100 мМ бикарбоната аммония и инкубируя в течение 10 минут перед удалением смывки. Этот процесс промывки повторяли еще 2 раза, прежде чем промывать один раз в 50 мкл ацетонитрила в течение 5 мин. Кускам геля давали высохнуть в течение 10 мин после удаления ацетонитрила. Восстановление и алкилирование белков осуществляли путем добавления 50 мкл свежеприготовленного 10 мМ дитиотреитола в 100 мМ бикарбоната аммония в течение 30 минут с последующим добавлением 50 мкл свежеприготовленного 55 мМ йодацетамида в 100 мМ бикарбоната аммония в течение 20 минут.Дополнительные 100 мкл ацетонитрила добавляли в течение 5 минут после восстановления и алкилирования, прежде чем удалить и выбросить жидкость. Затем образцы промывали в 50 мкл 100 мМ бикарбоната аммония в течение 10 минут с последующими 3 последовательными промывками в 50 мкл ацетонитрила, каждая продолжительностью 5 минут. Кусочкам геля позволяли обезвоживаться в течение 20 минут на горячей плите. После сушки к каждому образцу добавляли 25 мкл модифицированного трипсина, пригодного для секвенирования, с концентрацией 6 нг / мкл, восстановленного в 50 мМ бикарбонате аммония. Планшеты накрывали и давали инкубироваться в течение 3 ч при 50 ° C.После завершения протеолиза добавляли 30 мкл буфера для экстракции (муравьиная кислота 50:50: ацетонитрил), планшеты снова накрывали и инкубировали в течение 30 минут при 50 ° C. Раствор собирали и переносили в 96-луночный тонкостенный приемный планшет для ПЦР с твердой оболочкой и хранили при 4 ° C. Вторую экстракцию проводили с использованием 15 мкл буфера для экстракции с добавлением дополнительных 10 мкл ацетонитрила. После 30 мин инкубации при 50 ° C жидкость объединяли с первой экстракцией в приемном планшете.Планшеты для образцов лиофилизировали, и образцы восстанавливали в 10 мкл 5% ацетонитрила и 0,1% муравьиной кислоты в наночистой воде. Планшеты ненадолго центрифугировали перед введением в масс-спектрометр.

Для анализа ЖХ-МС / МС образцы вводили в капиллярную колонку 15 см (внутренний диаметр 75 мкм, внешний диаметр 360 мкм, размер наконечника 15 мкм), заполненный смолой Halo-Hilic (размер частиц 2,7 мкм, размер пор 90 Å). . Пептиды элюировали с помощью Waters NanoAcquity в 35-минутном линейном градиенте (от 15 до 35% ацетонитрила в 0.1% муравьиной кислоты) со скоростью 0,25 мкл / мин. Элюент направляли в масс-спектрометр LTQ-Velos Orbitrap Pro. Зависящие от данных сканы собирали в Orbitrap, а тандемные масс-спектры собирали в ионной ловушке. Поиск файлов данных ЖХ-МС / МС проводился с использованием Mascot Daemon v.2.2 (Matrix Science, Бостон, Массачусетс) по базе данных млекопитающих NCBI nr (обновление версии 7 августа 2012 г.). Параметры поиска включали от 2+ до 3+ зарядовых состояний, 2 пропущенных расщепления, переменную модификацию окисленного метионина и ошибки масс + 20 ppm для интактных спектров и + 0.8 Да для тандемных масс-спектров. Результаты поиска были скомпилированы в Scaffold v.2.0 (Proteome Software, Портленд, Орегон) и экспортированы в Microsoft Excel. Идентификации генов были присвоены с использованием собственного программного обеспечения с неоднозначными записями белков, подвергнутых поиску BLAST в человеческой базе данных SWISS-PROT. Все белки кератина, трипсина и иммуноглобулина были исключены из наборов данных как экзогенно введенные загрязнители. 58

Идентификация TmTNF-ассоциированной тяжелой цепи клатрина

Для идентификации TmTNF-ассоциированной тяжелой цепи клатрина DC (3 × 10 6 ) обрабатывали LPS в течение 2 часов при 37 ° C для индукции экспрессии на поверхности клетки. ТмТНФ.Клетки промывали и инкубировали в течение 10 мин в среде для выращивания, содержащей 5% инактивированной нагреванием сыворотки AB человека, с последующим добавлением либо человеческого IgG1 (15 мкг / мл), либо антител против TNF (15 мкг / мл) при 37 ° C в течение 5 дней. мин. Клетки дважды промывали ледяным PBS и общий белок экстрагировали с использованием буфера для лизиса клеток (50 мМ Tris-HCl, pH 8, 150 мМ NaCl, 1% н-октил-β-D-глюкозид, 1% Triton X-100, коктейль ингибиторов протеазы и 1 мМ PMSF) на льду в течение 45 мин. Образцы центрифугировали при 14000 x g в течение 10 минут при 4 ° C и осветленный супернатант переносили в свежую микроцентрифужную пробирку на льду.Для обогащения иммунных комплексов общие белки в 0,5 мл буфера для лизиса перемешивали конец за концом в течение 1 ч при 4 ° C, добавляя 50 мкл бусинок агарозы, конъюгированных с протеином А (Cell Signaling Technologies). Гранулы агарозы собирали центрифугированием при 2500 x g и последовательно промывали дважды (по 15 минут каждый) путем суспендирования в 1 мл ледяного буфера для лизиса и дважды (по 15 минут каждый) в 1 мл ледяного PBS. Белки подвергали SDS-PAGE хроматографии с последующим вестерн-иммуноблоттингом с использованием либо антител против TNF (R&D Systems; BAF210), либо антител против тяжелой цепи клатрина (ab21679, Lot {«type»: «entrez-нуклеотид», «attrs»: { «text»: «GR264025», «term_id»: «239568261», «term_text»: «GR264025»}} GR264025–1 от Abcam).

Выделение пептидов против TNF, связанных с клеточной поверхностью

Мягкая кислотная элюция

Пептиды, связанные с клеточной поверхностью, выделяли в мягких кислых условиях, как описано с некоторыми модификациями. 40 Вкратце, DC (∼6-8 × 10 6 ) обрабатывали LPS в течение 2 часов при 37 ° C, чтобы вызвать экспрессию TmTNF на клеточной поверхности. Клетки промывали и инкубировали с анти-TNF в среде для роста клеток при 37 ° C в течение 6–8 часов. Клетки дважды промывали ледяным PBS. Пептиды, ассоциированные с клеточной поверхностью, элюировали, инкубируя клетки в ледяном кислотном буфере для элюции (100 мМ глицин, pH 2.8, содержащий 150 мМ NaCl) на льду в течение 5 мин, и шаг повторяли один раз. Объединенные элюаты клеточной поверхности нейтрализовали, используя 1/10 (об. / Об.) 1 М Трис-HCl, pH 8, и подвергали ЖХ-МС / МС для идентификации пептидов против TNF с использованием секвенирующей масс-спектрометрии с высоким разрешением.

Иммунопреципитация HLA-DR

пептидов, ассоциированных с HLA класса II (HLA-DR), выделяли, как описано ранее, с некоторыми модификациями. 59 Вкратце, DC (∼8–10 × 10 6 ) обрабатывали LPS в течение 2 часов при 37 ° C, чтобы вызвать экспрессию TmTNF на клеточной поверхности.Клетки промывали и инкубировали с анти-TNF в среде для роста клеток при 37 ° C в течение до 8 часов. Клетки дважды промывали ледяным PBS и общий белок экстрагировали с использованием буфера для лизиса клеток (50 мМ трис-HCl, pH 8, 150 мМ NaCl, 1% н-октил-β-D-глюкозид, 1% тритон X-100, коктейль ингибиторов протеазы и 1 мМ PMSF) на льду в течение 45 мин. Образцы центрифугировали при 14000 x g в течение 10 минут при 4 ° C. Осветленный супернатант переносили в свежую микроцентрифужную пробирку на льду и оценивали общее количество белков с помощью реагента для анализа белков BCA (Thermo Fisher Scientific).Чтобы обогатить белок HLA класса II, 500–1000 мкг общих белков в 1 мл буфера для лизиса смешивали конец за концом в течение ночи при 4 ° C с 20 мкг мышиных IgG против HLA-DR человека (Biolegend). На следующий день иммунные комплексы были обогащены добавлением 50 мкл бусинок агарозы, конъюгированных с протеином G (Cell Signaling Technologies), и перемешивания образца при постоянном встряхивании в течение 2 ч при 4 ° C. Гранулы агарозы собирали центрифугированием при 2500 x g и последовательно промывали дважды (по 15 минут каждый) путем суспендирования в 1 мл ледяного буфера для лизиса и дважды (по 15 минут каждый) в 1 мл ледяного PBS.Белки элюировали из гранул, используя 0,2% трифторуксусную кислоту. Успешность аффинно очищенного HLA-DR подтверждали вестерн-иммуноблоттингом с использованием кроличьих антител против HLA-DR человека (ab
, Lot GR2651-7 от Abcam). Оставшиеся образцы подвергали центрифугированию с использованием спин-колонок с отсечкой 10 кДа (EMD Millipore) и проточной масс-спектрометрии с секвенированием с высоким разрешением (ЖХ-МС / МС) для идентификации пептидов против TNF.

Обнаружение пептидов против TNF с помощью LC-MS / MS

Пептиды клеточной поверхности, полученные из DC, как упомянуто выше, были подвергнуты идентификации пептидов с использованием системы капиллярной LC-MS, которая состоит из UPLC (система Acquity UPLC, Waters) в сочетании с масс-спектрометром скорости LTQ-Orbitrap (Thermo Fisher, Rockford, IL).Используемая колонка представляла собой обращенно-фазовую колонку C18 (Waters, BEH, внутренний диаметр 1 × 50 мм, размер частиц 1,7 мкм). Сорок мкл образца загружали в 98% подвижную фазу A (0,1% FA в воде Milli-Q) и 2% подвижную фазу B (0,1% FA в ацетонитриле), через 5 мин пептиды элюировали с использованием следующего градиента: 2% от подвижной фазы B до 20% подвижной фазы B за 60 минут, от 20% подвижной фазы B до 35% подвижной фазы B за 20 минут, 98% подвижной фазы B в течение 5 минут, 2% подвижной фазы B в течение 10 минут для уравновешивания. Скорость потока была установлена ​​на 50 мкл / мин, а температура термостата колонки была установлена ​​на 60 ° C.Масс-спектрометр работал в режиме положительных ионов с диапазоном сканирования от m / z 400 до 2000 с разрешением 60000 при m / z 400. Фрагментация пептидов была достигнута с использованием индуцированной столкновением диссоциации (CID) для 10 самых интенсивных родительских ионов. Значения автоматической регулировки усиления (AGC) для MS и MS / MS составляли 1E6 и 5E4 соответственно. Напряжение ионного распыления было установлено на уровне 4500 В, а температура источника была установлена ​​на уровне окружающей среды.

Чтобы идентифицировать пептиды из антитела против TNF или молекулы DVD, полученные необработанные данные масс-спектрометрии сравнивали с последовательностью антитела с использованием средства обнаружения протеома со специфичностью фермента, установленной как «без фермента.«Допуск по массе для MS составлял 10 ppm, а MS / MS — 0,2 Да. Положительные результаты поиска в базе данных были проверены вручную. В качестве альтернативы, необработанные данные сравнивали с базой данных последовательностей пептидов человеческого белка с использованием Mascot ™ (Matrix science) или PEAKS ™ (Bioinformatics Solutions).

Получение антител против слитого пептида против TNF-TT

Мы выбрали следующие 2 пептидные последовательности из разных областей белка столбнячного токсина 60 для слияния с С-концом тяжелой цепи антитела против TNF:

S1 Пептидная последовательность: 580-NSVDDALINSTKIYSYFPSV-599

S2 Пептидная последовательность: 919-NGKAIHLVNNESSEVIVHKAMDI-941

gBlock синтезированных фрагментов пептида, кодирующих указанные выше пептидные последовательности 5 ‘и 3’-перекрывающиеся последовательности родительской плазмиды AB436VH (pHybE-hIgG1, z, non-a, Abbvie).Нуклеотидные последовательности, кодирующие соответствующие S1 и S2 пептидов подчеркнуты ниже:

S1 Peptide нуклеотидной последовательности, кодирующей:

(caaccactacacgcagaagagcctctccctgtctccgggtaaaaacagcgtggacgacgccctgatcaacagcaccaagatctacagctacttccccagcgtgtgagcggccgctcgaggccggcaaggccggatcccccgacctcgacct)

S2 Пептид нуклеотидной последовательности, кодирующей (ccactacacgcagaagagcctctccctgtctccgggtaaaaacggcaaggccatccacctggtgaacaacgagagcagcgaggtgatcgtgcacaaggccatggacatctgagcggccgctcgaggccggcaaggccggatcccccgacctcga)

AB436VH, содержащая плазмидную ДНК (pHybE-hIgG1, г, non-a) расщепляли с использованием NotI (NEB) и очищали с помощью набора для очистки Qiaquick PCR (Qiagen).Фрагменты gBlock вставляли в линейную плазмиду путем гомологичной рекомбинации в компетентной DH5α E.coli (Invitrogen). Белки экспрессировали путем трансфекции соответствующих плазмид, кодирующих тяжелую цепь (AB436VH-S1, -S2, кодирующие нуклеотидные последовательности) и легкую цепь (AB436VL) в клетках HEK293-6E (ATCC) с использованием полиэтиленимина (PEI). 61 Семь дней спустя ТТ-гибридные mAb очищали с использованием хроматографии на протеине A (GE Healthcare) и подвергали диализу против PBS. SEC (AbbVie) подтвердил, что все антитела представляют собой агрегаты менее 10%.

Цитотоксический анализ L929

Чтобы убедиться в нейтрализующей эффективности гибридных антител против TNF-TT по сравнению с исходными антителами против TNF, мы провели анализ L929, как описано ранее. 52 Вкратце, мышиные клетки фибросаркомы L929 в логарифмической фазе собирали трипсинизацией, промывали и суспендировали в среде для роста клеток (RPMI, содержащая 10% FBS, 2 мМ L-глутамин, 1% Na-пируват, 1% заменимых аминокислот. , 0,1% β-меркаптоэтанола и 1% Pen / Strep). Клетки подсчитывали и высевали в трех экземплярах в 50 мкл среды для роста клеток с добавлением 2 мкг / мл актиномицина D (Sigma) в 96-луночные планшеты для тканевых культур при плотности клеток 1 × 10 6 клеток / мл при 37 ° C в увлажненной среде. 5% CO 2 инкубатор.Начиная с 10 нМ, 1: 3 серийные разведения антител против TNF, подлежащих тестированию, и 100 пг / мл рекомбинантного человеческого TNF проводили отдельно в среде для роста клеток, смешивали и инкубировали при комнатной температуре в течение 1 часа. 50 мкл вышеуказанных разведений анти-TNF: TNF добавляли в лунки, содержащие клетки L929, чтобы получить конечную концентрацию 1 мкг / мл актиномицина D на лунку вместе с соответствующими положительными (содержащими только TNF) и отрицательными (без TNF). контролирует. Клетки инкубировали в течение ∼18 ч при 37 ° C в увлажненной атмосфере с 5% CO 2 .Свежеприготовленный реагент для определения пролиферации клеток, WST-1 (Roche), добавляли в каждую лунку для оценки жизнеспособности клеток, и клетки дополнительно инкубировали при 37 ° C в увлажненной атмосфере с 5% CO 2 в течение 4 часов. Поглощение регистрировали с помощью планшет-ридера Spectramax (Molecular Devices) при 420-600 нм для спектрофотометрической количественной оценки жизнеспособности клеток. Кривая нелинейной регрессии была построена путем нанесения концентраций антител в логарифмическом масштабе по оси абсцисс и ОП по оси ординат.

Анализ пролиферации Т-клеток

DC были получены из CD14 + моноцитов из PBMC здоровых людей-доноров, которые были иммунизированы столбнячным анатоксином и стимулированы 250 нг / мл LPS Salmonella typhimurium в течение 2 часов при 37 ° C для индукции экспрессии. ТмТНФ. ДК обрабатывали либо TT (20 мкг / мл), либо пептидами TT (S1 или S2), конъюгированными анти-TNF-антителами (анти-TNF-S1 или анти-TNF-S2; 20 мкг / мл каждого) и инкубировали в среде для роста клеток. при 37 ° C в течение дополнительных 6 часов. Аутологичные Т-клетки очищали из PBMC того же донора, от которого были получены моноциты, для генерации DC с использованием набора для выделения пан-Т-клеток (Miltenyi) и метили 2.5 мкМ CFSE (Invitrogen). ДК промывали дважды после введения антител и культивировали с аутологичными Т-клетками в соотношении 1:50 в течение до 7 дней. Пролиферацию Т-клеток оценивали с помощью проточной цитометрии. Процент живых Т-клеток, которые подверглись клеточному делению, определяли путем стробирования по DAPI-отрицательным CD3 + клеткам и оценки фракции, которая показывала уменьшенную интенсивность флуоресценции CFSE. 62

Раскрытие информации о потенциальных конфликтах интересов

Арун Деора, Субраманья Хегде, Жаклин Ли, Чи-Хо Чой, Цин Чанг, Шерил Ли, Люсия Итон, Хуа Тан, Марк Михалак, Медха Томлинсон, Цинфенг Тао, Богдан Харви , Шон Маклафлин, Борис Лабковский и Тарик Гаюр — сотрудники AbbVie Inc.и может владеть акциями или опционами AbbVie. Нидхи Гаур, Дэвид Ли и Донгдонг Ван были сотрудниками AbbVie на момент исследования. Авторы не имеют других соответствующих аффилированных или финансовых связей с какой-либо другой организацией или юридическим лицом, имеющим финансовый интерес или конфликт с предметом или материалами, обсуждаемыми в текущей рукописи. Дизайн, проведение исследования и финансовая поддержка этого исследования были предоставлены AbbVie. AbbVie участвовала в сборе, анализе и интерпретации данных, рецензировании и утверждении публикации.

Благодарности

Авторы выражают признательность и благодарность за поддержку и отзывы, предоставленные Джиджи Гу, Робертом Стоффелем, Йохеном Салфельдом и Лизой Олсон.

Ссылки

1. Перес К., Альберт I, ДеФэй К., Захариадес Н., Гудинг Л., Криглер М. Несекретируемый мутант фактора некроза опухоли (TNF) на клеточной поверхности убивает посредством межклеточного контакта. Клетка 1990; 63: 251-8; PMID: 2208285; http://dx.doi.org/10.1016/0092-8674(90)

-B [PubMed] [CrossRef] [Google Scholar] 2. Криглер М., Перес К., ДеФей К., Альберт I, Лу С.Д.Новая форма TNF / кахектина представляет собой цитотоксический трансмембранный белок клеточной поверхности: ответвления для сложной физиологии TNF. Клетка 1988; 53: 45-53; PMID: 3349526; http://dx.doi.org/10.1016/0092-8674(88)-2 [PubMed] [CrossRef] [Google Scholar] 3. Хориучи Т., Митома Х, Харашима С., Цукамото Х., Симода Т. Трансмембранный TNF-альфа: структура, функция и взаимодействие с анти-TNF агентами. Ревматология (Оксфорд) 2010; 49: 1215-28; PMID: 20194223; http://dx.doi.org/10.1093/rheumatology/keq031 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4.Jiang H, Khan S, Wang Y, Charron G, He B, Sebastian C, Du J, Kim R, Ge E, Mostoslavsky R. и др .. SIRT6 регулирует секрецию TNF-альфа посредством гидролиза длинноцепочечного жирного ациллизина. Природа 2013; 496: 110-3; PMID: 23552949; http://dx.doi.org/10.1038/nature12038 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 5. Friedmann E, Hauben E, Maylandt K, Schleeger S, Vreugde S, Lichtenthaler SF, Kuhn PH, Stauffer D, Rovelli G, Martoglio B. SPPL2a и SPPL2b способствуют внутримембранному протеолизу TNFalpha в активированных дендритных клетках, чтобы запустить продукцию IL-12.Nat Cell Biol 2006; 8: 843-8; PMID: 16829952; http://dx.doi.org/10.1038/ncb1440 [PubMed] [CrossRef] [Google Scholar] 6. Флюрер Р., Граммер Г., Израиль Л., Кондрон М. М., Хаффнер С., Фридман Э., Бёланд С., Имхоф А., Мартольо Б., Теплов Д. Б. и др. Подобное гамма-секретазе внутримембранное расщепление TNF-альфа аспартил-протеазой GxGD SPPL2b. Nat Cell Biol 2006; 8: 894-6; PMID: 16829951; http://dx.doi.org/10.1038/ncb1450 [PubMed] [CrossRef] [Google Scholar] 7. Pallai A, Kiss B, Вереб G, Armaka M, Kollias G, Szekanecz Z, Szondy Z.Трансмембранная обратная передача сигналов TNF-альфа ингибирует индуцированное липополисахаридом образование провоспалительных цитокинов в макрофагах путем индукции TGF-бета: терапевтическое значение. J Immunol 2016; 196: 1146-57; PMID: 26729808; http://dx.doi.org/10.4049/jimmunol.1501573 [PubMed] [CrossRef] [Google Scholar] 8. Смит CA, Фарра Т., Гудвин Р.Г. Суперсемейство клеточных и вирусных белков рецепторов TNF: активация, костимуляция и смерть. Клетка 1994; 76: 959-62; PMID: 8137429; http://dx.doi.org/10.1016/0092-8674(94)-7 [PubMed] [CrossRef] [Google Scholar] 9.Watts AD, Onier-Cherix N, Hunt NH, Chaudhri G. Использование фиксированных клеток в анализах клеточно-зависимой цитотоксичности для TNF: предупреждающий отчет. J Immunol методы 1999; 225: 179-84; PMID: 10365794; http://dx.doi.org/10.1016/S0022-1759(99)00046-0 [PubMed] [CrossRef] [Google Scholar] 10. де Ваал Малефит Р., Абрамс Дж., Беннетт Б., Фигдор К. Г., де Фрис Дж. Э. Интерлейкин 10 (ИЛ-10) подавляет синтез цитокинов моноцитами человека: ауторегуляторная роль ИЛ-10, продуцируемого моноцитами. J Exp Med 1991; 174: 1209-20; PMID: 1940799; http: // dx.doi.org/10.1084/jem.174.5.1209 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 11. Хо Л.Дж., Ван Дж.Дж., Шайо М.Ф., Као К.Л., Чанг Д.М., Хан С.В., Лай Дж.Х. Заражение дендритных клеток человека вирусом денге вызывает созревание клеток и выработку цитокинов. J Immunol 2001; 166: 1499-506; PMID: 11160189; http: //dx.doi.org/10.4049/jimmunol.166.3.1499 [PubMed] [CrossRef] [Google Scholar] 12. Брем М.А., Дэниэлс К.А., Валлийский РМ. Быстрое производство TNF-альфа после вовлечения TCR наивных CD8 T-клеток. J Immunol 2005; 175: 5043-9; PMID: 16210607; http: // dx.doi.org/10.4049/jimmunol.175.8.5043 [PubMed] [CrossRef] [Google Scholar] 13. Уильямсон Б.Д., Карсуэлл Е.А., Рубин Б.А., Прендергаст Дж.С., Старый Ж. Фактор некроза опухоли человека, продуцируемый линиями В-клеток человека: синергетическое цитотоксическое взаимодействие с человеческим интерфероном. Proc Natl Acad Sci U S A 1983; 80: 5397-401; PMID: 6193516; http://dx.doi.org/10.1073/pnas.80.17.5397 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Fauriat C, Long EO, Ljunggren HG, Bryceson YT. Регулирование продукции цитокинов и хемокинов человеческими NK-клетками путем распознавания клеток-мишеней.Кровь 2010; 115: 2167-76; PMID: 19965656; http://dx.doi.org/10.1182/blood-2009-08-238469 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Култхард Л.Р., Гейлер Дж., Мэтьюз Р.Дж., Черч Л.Д., Дики Л.Дж., Купер Д.Л., Вонг С., Савик С., Брайер Д., Бух М.Х. и др .. Дифференциальные эффекты инфликсимаба на абсолютное количество лейкоцитов в крови врожденных иммунных клеток у пациентов с ранним и поздним ревматоидным артритом. Клин Эксп Иммунол 2012; 170: 36-46; PMID: 22943199; http://dx.doi.org/10.1111/j.1365-2249.2012.04626.x [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16. Имаидзуми Т., Итая Х., Фудзита К., Кудо Д., Кудо С., Мори К., Фудзимото К., Мацумия Т., Ёсида Х., Сато К. Экспрессия фактора некроза опухоли-альфа в культивируемых эндотелиальных клетках человека, стимулированных липополисахаридом или интерлейкином-1альфа. Артериосклер Thromb Vasc Biol 2000; 20: 410-5; PMID: 10669637; http://dx.doi.org/10.1161/01.ATV.20.2.410 [PubMed] [CrossRef] [Google Scholar] 18. Хавелл Э.А., Роджерсон Б.Дж. Эндотоксин-индуцированный синтез фактора некроза опухоли альфа в фибробластах мышиных эмбрионов.Заразить иммунную 1993; 61: 1630-5; PMID: 8478050. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Накао А., Фукусима Х, Кадзия Х, Озеки С., Окабе К. Стимулируемая RANKL продукция TNFalpha в клетках-предшественниках остеокластов способствует остеокластогенезу путем модуляции сигнальных путей RANK. Biochem Biophys Res Commun 2007; 357: 945-50; PMID: 17467668; http://dx.doi.org/10.1016/j.bbrc.2007.04.058 [PubMed] [CrossRef] [Google Scholar] 20. Аггарвал BB. Сигнальные пути суперсемейства TNF: палка о двух концах.Нат Рев Иммунол 2003; 3: 745-56; PMID: 12949498; http://dx.doi.org/10.1038/nri1184 [PubMed] [CrossRef] [Google Scholar] 21. Хидра Д., Форселаарс А.Д., Грутерс Дж. С., Клаессен А. М., Райкерс Г. Т.. Дифференциальная экспрессия TNFR1 (CD120a) и TNFR2 (CD120b) в субпопуляциях моноцитов человека. J Inflamm (Лондон) 2012; 9:38; PMID: 23039818; http://dx.doi.org/10.1186/1476-9255-9-38 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 22. Грелль М., Дуни Э., Ваджант Х., Лоден М., Клаусс М., Максайнер Б., Георгопулос С., Лесслауэр В., Коллиас Г., Пфизенмайер К. и др.. Трансмембранная форма фактора некроза опухоли является основным активирующим лигандом рецептора фактора некроза опухоли 80 кДа. Клетка 1995; 83: 793-802; PMID: 8521496; http://dx.doi.org/10.1016/0092-8674(95)

-2 [PubMed] [CrossRef] [Google Scholar] 23. Батон Дж. М., Мартин Р. В., Флейшманн Р. М., Тессер Дж. Р., Шифф М. Х., Keystone EC, Дженовезе М.С., Васко М.К., Мореланд Л.В., Уивер А.Л. и др .. Сравнение этанерцепта и метотрексата у пациентов с ранним ревматоидным артритом. N Engl J Med 2000; 343: 1586-93; PMID: 11096165; http: // dx.doi.org/10.1056/NEJM200011303432201 [PubMed] [CrossRef] [Google Scholar] 24. Lipsky PE, van der Heijde DM, St Clair EW, Furst DE, Breedveld FC, Kalden JR, Smolen JS, Weisman M, Emery P, Feldmann M и др .. Инфликсимаб и метотрексат в лечении ревматоидного артрита. Испытание противоопухолевого фактора некроза при ревматоидном артрите с группой изучения сопутствующей терапии. N Engl J Med 2000; 343: 1594-602; PMID: 11096166; http://dx.doi.org/10.1056/NEJM200011303432202 [PubMed] [CrossRef] [Google Scholar] 25.Targan SR, Hanauer SB, van Deventer SJ, Mayer L, Present DH, Braakman T., DeWoody KL, Schaible TF, Rutgeerts PJ. Краткосрочное исследование химерного моноклонального антитела cA2 к фактору некроза опухоли альфа при болезни Крона. Группа изучения болезни Крона cA2. N Engl J Med 1997; 337: 1029-35. [PubMed] [Google Scholar] 26. Баерт Ф.Дж., Д’Хаенс Г.Р., Пеэтерс М., Хиле М.И., Шейбл Т.Ф., Шили Д., Гебоэс К., Рутгертс П.Дж. Терапия антителом к ​​фактору некроза опухоли (инфликсимаб) значительно подавляет воспаление при илеоколите Крона.Гастроэнтерология 1999; 116: 22-8; PMID: 9869598; http://dx.doi.org/10.1016/S0016-5085(99)70224-6 [PubMed] [CrossRef] [Google Scholar] 27. Маллберг Дж., Дьюри Ф. Х., Оттен-Эванс К., Олдерсон М. Р., Роуз-Джон С., Косман Д., Блэк Р. А., Молер К. М.. Ингибитор металлопротеиназы блокирует выделение рецептора IL-6 и рецептора p60 TNF. J Immunol 1995; 155: 5198-205; PMID: 7594530 [PubMed] [Google Scholar] 28. Геринг А.Дж., Беккет П., Христодулу М., Черчилль М., Клементс Дж., Дэвидсон А.Х., Драммонд А.Х., Галлоуэй В.А., Гилберт Р., Гордон Дж.Л. и др.. Обработка предшественника фактора некроза опухоли альфа металлопротеиназами. Природа 1994; 370: 555-7; PMID: 8052310; http://dx.doi.org/10.1038/370555a0 [PubMed] [CrossRef] [Google Scholar] 29. Mayor S, Pagano RE. Пути клатриннезависимого эндоцитоза. Нат Рев Мол Cell Biol 2007; 8: 603-12; PMID: 17609668; http://dx.doi.org/10.1038/nrm2216 [PubMed] [CrossRef] [Google Scholar] 30. Соркин А., фон Застров М. Эндоцитоз и передача сигналов: переплетающиеся молекулярные сети. Нат Рев Мол Cell Biol 2009; 10: 609-22; PMID: 19696798; http: // dx.doi.org/10.1038/nrm2748 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Чаттерджи Б., Смед-Соренсен А., Кон Л., Чалуни С., Вандлен Р., Ли BC, Видгер Дж., Келер Т., Деламар Л., Меллман И. Интернализация и эндосомная деградация антигенов, связанных с рецептором, регулируют эффективность перекрестной презентации дендритными клетками человека. Кровь 2012; 120: 2011-20; PMID: 227; http://dx.doi.org/10.1182/blood-2012-01-402370 [PubMed] [CrossRef] [Google Scholar] 32. Чжан Х, Ян Д., Ши Х, Лян Х, Панг И, Цинь Н, Чен Х, Ван Дж, Инь Б, Цзян Х и др.. Трансмембранный TNF-альфа опосредует «прямую» и «обратную» передачу сигналов, вызывая гибель или выживание клеток через путь NF-kappaB в клетках лимфомы Раджи Беркитта. J Leukoc Biol 2008; 84: 789-97; PMID: 18550789; http://dx.doi.org/10.1189/jlb.0208078 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Микса М., Комура Х, Ву Р., Шах К.Г., Ван П. Новый метод определения поглощения апоптотических клеток макрофагами с использованием сложного эфира pHrodo сукцинимидила. J Immunol методы 2009; 342: 71-7; PMID: 146; http: // dx.doi.org/10.1016/j.jim.2008.11.019 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Хоус М.Т., Киркхэм М., Ричес Дж., Кортез К., Уолзер П.Дж., Симпсон Ф., Хилл М.М., Джонс А., Лундмарк Р., Линдси М.Р. и др .. Клатрин-независимые носители образуют высокопроизводительную систему сортировки эндоцитов на переднем крае мигрирующих клеток. J Cell Biol 2010; 190: 675-91; PMID: 20713605; http://dx.doi.org/10.1083/jcb.201002119 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 35. Харпер С.Б., Мартин С., Нгуен Т.Х., Дэниэлс С.Дж., Лавидис Н.А., Попофф М.Р., Хаджич Дж., Мариана А., Чау Н., Маккласки А. и др.. Ингибирование динамина блокирует эндоцитоз ботулинического нейротоксина типа А в нейронах и задерживает ботулизм. J Biol Chem 2011; 286: 35966-76; PMID: 21832053; http://dx.doi.org/10.1074/jbc.M111.283879 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 36. Wu C, Ying H, Grinnell C, Bryant S, Miller R, Clabbers A, Bose S, McCarthy D, Zhu RR, Santora L и др .. Одновременное нацеливание на несколько медиаторов заболевания с помощью иммуноглобулина с двумя вариабельными доменами. Nat Biotechnol 2007; 25: 1290-7; PMID: 17934452; http: // dx.doi.org/10.1038/nbt1345 [PubMed] [CrossRef] [Google Scholar] 37. Cousens LP, Tassone R, Mazer BD, Ramachandiran V, Scott DW, De Groot AS. Обновление трегитопа: механизм действия аналогичен IVIg. Аутоиммунный Rev 2013; 12: 436-43; PMID: 22944299; http://dx.doi.org/10.1016/j.autrev.2012.08.017 [PubMed] [CrossRef] [Google Scholar] 38. Мэтьюз С.П., Вербер И., Деуссинг Дж., Питерс К., Райнхекель Т., Уоттс К. Четкие требования к протеазе для презентации антигена in vitro и in vivo. J Immunol 2010; 184: 2423-31; PMID: 20164435; http: // dx.doi.org/10.4049/jimmunol.06 [PubMed] [CrossRef] [Google Scholar] 39. Акассоглу К., Дуни Э., Бауэр Дж., Лассманн Х., Коллиас Г., Проберт Л. Передача сигналов эксклюзивного фактора некроза опухоли (TNF) рецептором p75TNF запускает воспалительную ишемию в ЦНС трансгенных мышей. Proc Natl Acad Sci U S A 2003; 100: 709-14; PMID: 12522266; http://dx.doi.org/10.1073/pnas.0236046100 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. Люеттиг Б., Деккер Т., Ломанн-Маттес М.Л. Доказательства существования двух форм мембранного фактора некроза опухоли: интегрального белка и молекулы, прикрепленной к его рецептору.J Immunol 1989; 143: 4034-8; PMID: 2556474 [PubMed] [Google Scholar] 41. Митома Х, Хориучи Т., Хатта Н., Цукамото Х., Харашима С., Кикучи Ю., Оцука Дж., Окамура С., Фудзита С., Харада М. Инфликсимаб вызывает сильные противовоспалительные реакции посредством сигналов снаружи внутрь через трансмембранный TNF-альфа. Гастроэнтерология 2005; 128: 376-92; PMID: 15685549; http://dx.doi.org/10.1053/j.gastro.2004.11.060 [PubMed] [CrossRef] [Google Scholar] 42. Сен-Пьер, Калифорния, Леонард Д., Корвера С., Курт-Джонс Е.А., Финберг Р.В. Антитела к белкам клеточной поверхности перенаправляют пути внутриклеточного транспорта.Опыт Мол Патол 2011; 91: 723-32; PMID: 21819978; http://dx.doi.org/10.1016/j.yexmp.2011.05.011 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 43. Qiao SW, Kobayashi K, Johansen FE, Sollid LM, Andersen JT, Milford E, Roopenian DC, Lencer WI, Blumberg RS. Зависимость опосредованной антителами презентации антигена от FcRn. Proc Natl Acad Sci U S A 2008; 105: 9337-42; PMID: 18599440; http://dx.doi.org/10.1073/pnas.0801717105 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 44. Фудзимото К., Ида Х, Хирота Ю., Исигай М., Амано Дж., Танака Ю.Внутриклеточная динамика и судьба гуманизированного моноклонального антитела против рецептора интерлейкина-6, тоцилизумаба. Мол Фармакол 2015; 88: 660-75; PMID: 26180046; http://dx.doi.org/10.1124/mol.115.099184 [PubMed] [CrossRef] [Google Scholar] 45. Меллман I, Плутнер Х., Укконен П. Интернализация и быстрая рециклинг макрофагальных рецепторов Fc, меченных моновалентными антирецепторными антителами: возможная роль пролизосомального компартмента. J Cell Biol 1984; 98: 1163-9; PMID: 6715403; http://dx.doi.org/10.1083/jcb.98.4.1163 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 46. Bonifaz LC, Bonnyay DP, Charalambous A, Darguste DI, Fujii S, Soares H, Brimnes MK, Moltedo B, Moran TM, Steinman RM. Нацеливание in vivo антигенов на созревающие дендритные клетки через рецептор DEC-205 улучшает вакцинацию Т-клетками. J Exp Med 2004; 199: 815-24; PMID: 15024047; http://dx.doi.org/10.1084/jem.20032220 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Шеллекенс Х. Иммуногенность терапевтических белков: клиническое значение и перспективы на будущее.Clin Ther 2002; 24: 1720-40; обсуждение 19; PMID: 12501870; http://dx.doi.org/10.1016/S0149-2918(02)80075-3 [PubMed] [CrossRef] [Google Scholar] 48. Россол М., Мойш У., Пирер М., Кальтенхаузер С., Ханцшель Х., Хаушильдт С., Вагнер У. Взаимодействие между трансмембранным TNF и TNFR1 / 2 опосредует активацию моноцитов путем контакта с Т-клетками. J Immunol 2007; 179: 4239-48; PMID: 17785864; http://dx.doi.org/10.4049/jimmunol.179.6.4239 [PubMed] [CrossRef] [Google Scholar] 49. Слевин С.М., Иган Л.Дж. Новые сведения о механизмах действия моноклональных антител против фактора некроза опухолей альфа при воспалительном заболевании кишечника.Воспаление кишечника 2015; 21: 2909-20; PMID: 26348448; http://dx.doi.org/10.1097/MIB.0000000000000533 [PubMed] [CrossRef] [Google Scholar] 50. Вос А.С., Вильденберг М.Э., Дуйвесттайн М., Верхаар А.П., ван ден Бринк Г.Р., Хоммес Д.В. Антитела против фактора некроза опухоли альфа индуцируют регуляторные макрофаги зависимым от области Fc образом. Гастроэнтерология 2011; 140: 221-30; PMID: 20955706; http://dx.doi.org/10.1053/j.gastro.2010.10.008 [PubMed] [CrossRef] [Google Scholar] 51. Нгуен DX, Эренштейн MR. Анти-TNF стимулирует рост регуляторных Т-клеток, парадоксальным образом способствуя мембранному связыванию TNF-TNF-RII при ревматоидном артрите.J Exp Med 2016; 213: 1241-53; PMID: 27270893; http://dx.doi.org/10.1084/jem.20151255 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 52. Shiau MY, Chiou HL, Lee YL, Kuo TM, Chang YH. Создание согласованной системы биоанализа L929 для количественного определения TNF-альфа для оценки влияния липополисахаридов, фитомитогенов и агентов цитодифференцировки на цитотоксичность TNF-альфа, секретируемого прикрепленными мононуклеарными клетками человека. Медиаторы воспаления 2001; 10: 199-208; PMID: 11577996; http://dx.doi.org/10.1080/09629350123139 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 53. Диспенсери С., Саба Е., Виченци Е., Коотстра Н.А., Шуйтемакер Х., Скарлатти Г. Выделение ВИЧ-1 из инфицированных мононуклеарных клеток периферической крови. Методы Мол Биол 2014; 1087: 187-96; PMID: 24158823 [PubMed] [Google Scholar] 54. Эйшен А., Винсент Ф., Бержерат Дж. П., Луи Б., Фараджи А., Бохбот А., Оберлинг Ф. Долгосрочные культуры моноцитов человека in vitro. Влияние GM-CSF на выживаемость и дифференциацию. J Immunol методы 1991; 143: 209-21.[PubMed] [Google Scholar] 55. Молодой Д.А., Лоу Л.Д., Кларк СК. Сравнение эффектов IL-3, гранулоцитарно-макрофагального колониестимулирующего фактора и макрофагального колониестимулирующего фактора в поддержке дифференцировки моноцитов в культуре. Анализ макрофагальной антителозависимой клеточной цитотоксичности. J Immunol 1990; 145: 607-15; PMID: 2142182 [PubMed] [Google Scholar] 56. Деора А.Б., Крейцер Г., Яковина А.Т., Хаджар К.А. Переключатель фосфорилирования аннексина 2 опосредует p11-зависимую транслокацию аннексина 2 на поверхность клетки.J Biol Chem 2004; 279: 43411-8; PMID: 15302870; http://dx.doi.org/10.1074/jbc.M408078200 [PubMed] [CrossRef] [Google Scholar] 57. Огава М., Косака Н., Регино, Калифорния, Мицунага М., Чойк П.Л., Кобаяси Х. Высокочувствительное обнаружение рака in vivo с использованием флуоресцентного зонда для визуализации с двойной контролируемой активацией на основе образования H-димера и активации pH. Мол Биосист 2010; 6: 888-93; PMID: 20567775; http://dx.doi.org/10.1039/b6g [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 58. Шевченко А, Томас Х, Хавлис Дж, Олсен СП, Манн М.Расщепление в геле для масс-спектрометрической характеристики белков и протеомов. Нат Проток 2006; 1: 2856-60; PMID: 17406544; http://dx.doi.org/10.1038/nprot.2006.468 [PubMed] [CrossRef] [Google Scholar] 59. ван Харен С.Д., Херченик Э., тен Бринке А., Мертенс К., Ворберг Дж., Мейер А.Б. Репертуары представленных HLA-DR пептидов, полученных из дендритных клеток, происходящих из моноцитов человека, подвергнутых воздействию фактора свертывания крови VIII. Протеомика клеток Mol 2011; 10: M110 002246; PMID: 21467215; http://dx.doi.org/10.1074/mcp.M110.002246 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 60. Фэйрвезер Н.Ф., Лайнесс В.А. Полная нуклеотидная последовательность столбнячного токсина. Нуклеиновые кислоты Res 1986; 14: 7809-12; PMID: 3774547; http://dx.doi.org/10.1093/nar/14.19.7809 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 61. Гу Дж, Ян Дж, Чанг Кью, Лю З., Гаюр Т., Гу Дж. Идентификация белков иммуноглобулинов (DVD-Ig) с двойными вариабельными доменами против EGFR и против ErbB3 с уникальной активностью. PLoS One 2015; 10: e0124135; PMID: 25997020; http: // dx.doi.org/10.1371/journal.pone.0124135 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 62. Hegde S, Jankowska-Gan E, Roenneburg DA, Torrealba J, Burlingham WJ, Gumperz JE. NKT-клетки человека способствуют дифференцировке моноцитов в супрессивные миелоидные антигенпрезентирующие клетки. J Leukoc Biol 2009; 86: 757-68; PMID: 19465641; http://dx.doi.org/10.1189/jlb.0209059 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Frontiers | Исследование фронтальной отрицательной медленной волны в задаче виртуальной гедонической покупки

Введение

За последние несколько лет фронтальная отрицательная медленная волна (FNSW) обсуждалась в тесте скрытой информации (CIT), а также в исследованиях потребительской нейробиологии.CIT используется для исследования памяти (Verschuere et al., 2011) и в основном делается для выяснения того, знает ли преступник относящуюся к преступлению информацию, используя физиологические реакции. Во время CIT экзаменуемым предоставляется предмет, относящийся к преступлению, и несколько предметов, не относящихся к преступлению. Невинные люди не могут отличить предмет, имеющий отношение к преступлению, от предметов, не относящихся к преступлению, тогда как подозреваемые могут распознать информацию, имеющую отношение к преступлению, и попытаться сделать вид, что отреагируют так же, как и первая группа. Однако у испытуемых, причастных к преступлению, можно наблюдать изменение физиологических реакций на предмет, имеющий отношение к преступлению, например, увеличение проводимости кожи, снижение частоты сердечных сокращений и подавление дыхания (Gamer, 2011; Matsuda and Nittono, 2018b).Кроме того, FNSW был обнаружен в исследовании CIT. Когда субъекты были проинструктированы как преступники, они выбирали подавление переживаемого физиологического возбуждения для предмета, имеющего отношение к преступлению, чтобы не быть обнаруженными, что проявлялось в увеличении FNSW (Matsuda and Nittono, 2015b, 2018a). Кроме того, оценка источника с помощью стандартизированной электромагнитной томографии головного мозга с низким разрешением (sLORETA) для FNSW показала, что большая активация (связанные с преступлением — элементы, не имеющие отношения к преступлению) возникала в правой средней лобной извилине и правой нижней лобной извилине, когда субъекты пытались скрыть элемент, не имеющий отношения к преступлению (Matsuda and Nittono, 2018a).

В отличие от отражения конкретного процесса сокрытия, FNSW может иметь отношение к предпочтениям потребителей (Goto et al., 2017). В задаче виртуального шоппинга участникам было показано изображение продукта, впоследствии они ответили на вопросы, касающиеся их симпатий к продукту, и, наконец, решили, покупать продукт или нет, с указанием его цены. В соответствии с предпочтениями участников продукты были разделены на категории с низким, средним и высоким предпочтением. Потенциал, связанный с событием (ERP), был измерен, когда была представлена ​​фотография продукта.По сравнению с другими продуктами, мотивационное взаимодействие с наиболее предпочтительными продуктами было увеличено, что привело к расхождению в FNSW (400–800 мс) (Goto et al., 2017).

Учитывая, что FNSW ассоциируется с подавлением возбуждения (т. Е. Подавлением реакции на предмет, имеющий отношение к преступлению) (Matsuda and Nittono, 2015b, 2018a), отмечается, связано ли FNSW (400-800 мс) с предпочтением потребительских товаров. отражает процесс подавления реакции на некоторую информацию, а также в некотором торговом контексте.Wertenbroch (1998) показал, что у импульсивных потребителей ожидаемая стоимость потребления большего количества гедонистических предметов была меньше, чем утилитарных. Напротив, благоразумные люди демонстрируют обратное поведение, которое подтверждает утверждение о том, что гедонический образ мышления отличается, а также изображает подавление желания использовать гедонистические продукты для развлечения у импульсивных потребителей (Wertenbroch, 1998). Таким образом, стоит изучить, может ли различное гедонистическое покупательское поведение импульсивных и осмотрительных потребителей проявляться в несоответствии FNSW (400–800 мс), отражающем торможение.

Чтобы исключить объяснение того, что несоответствие в FNSW между импульсивными и осторожными потребителями является результатом разной готовности к покупке в сочетании с предпочтениями потребителей (Goto et al., 2017), мы также исследуем влияние двух типов продвижения: ценовое продвижение. и сочетание поощрения (сочетание скидки и благотворительного пожертвования) по гедонистическому принятию решения о покупке. В повседневной жизни гедонистические продукты не нужны для нашего основного благополучия. В результате потребителям нужны веские причины для оправдания гедонистического потребления.Повышение цен (Kivetz and Zheng, 2017), пожертвования на благотворительность (Strahilevitz and Myers, 1998), раздача подарков (Lu et al., 2016) могут служить оправданием. Например, продвижение цен может облегчить конфликт между желанием потакать своим слабостям и тем фактом, что гедонистическая покупка не имеет значения для их повседневной жизни и, как таковая, побуждает потребителей лучше достигать своих гедонистических целей (Kivetz and Zheng, 2017). Пожертвование на благотворительность оказывает такое же положительное влияние на количество покупок гедонистических продуктов (Strahilevitz and Myers, 1998).Более того, денежные стимулы имеют положительное или отрицательное влияние на пожертвования на благотворительность. Например, Landry et al. (2010) обнаружили, что денежные стимулы вытесняют благотворительные пожертвования от предыдущих жертвователей, но не от новых. Однако денежное вознаграждение может повысить уровень сдачи крови (Lacetera and Macis, 2010). Хотя повышение цен является своего рода денежным стимулом и, как таковое, влияет на пожертвования на благотворительность, остается неясным, являются ли гедонистические продукты со скидкой и благотворительным пожертвованием лучшим или худшим выбором для покупки, чем те, которые только с повышением цены.

Чтобы улучшить обоснование текущего исследования, мы также имеем представление о нейронных механизмах, лежащих в основе принятия гедонистических решений о покупке в различных рекламных акциях. В частности, в настоящем исследовании мы обсуждали компонент N2, отличный от FNSW (400–800 мс). N2 как общий негативно идущий компонент ERP достигает пика примерно через 250–350 мс после предъявления стимула с максимумом во фронтальной области (Folstein and Van Petten, 2008). В исследованиях потребительской нейробиологии N2 связан с конфликтом восприятия (например,г., Ma et al., 2007; Wang et al., 2016). Например, когда участникам сообщили, что предметы роскоши являются поддельными, они ожидали, что эти предметы будут иметь заметный логотип бренда. Таким образом, если логотип бренда для контрафактной продукции будет незаметен, возникнет конфликт ожиданий и возникнет повышенная амплитуда N2 (Zhang et al., 2019). В настоящем исследовании эффект ослабления внутриличностного конфликта, заключающийся в том, что гедонистическое потребление не является необходимым для удовлетворения основных потребностей, различается между смешанным продвижением и чистым продвижением цен, что может привести к разнице в амплитуде N2.

Таким образом, мы прогнозируем, что у импульсивных потребителей, которые подавляют стремление к гедонистическим продуктам и реакцию на рекламную информацию, увеличится FNSW, по сравнению с осмотрительными потребителями. Мы ожидаем, что покупательское поведение в смешанных и чистых ценовых рекламных акциях может проявиться в компоненте N2, поскольку эти рекламные акции могут иметь различное влияние на ослабление внутриличностного конфликта.

Материалы и методы

Участников

Предыдущий анализ мощности предложил размер выборки из 33 участников для обнаружения средних эффектов в смешанном дизайне ANOVA ( f = 0.25, α = 0,05, β = 0,80; G Мощность 3.1; Faul et al., 2009). Чтобы сохранить хотя бы размер, эксперимент был завершен сорока студентами (15 мужчин, средний возраст: 19,40; 25 женщин, средний возраст: 19,28 лет), у которых было нормальное или скорректированное до нормального зрение без каких-либо неврологических расстройств в анамнезе или психические заболевания. Все участники сами сообщили, что они правши и что все они носители китайского языка. Это исследование было одобрено наблюдательным советом учреждения, и до начала эксперимента было получено письменное согласие.

Экспериментальные стимулы

Всего было выбрано (50) изображений закусок (то есть небольшой еды, например, плитки шоколада) как гедонистических предметов, гедонистическая оценка которых выше, чем утилитарная оценка (Jing et al., 2019), и преобразованы в аналогичный размер, 300 × 300 пикселей. Как показано на Рисунке 1, для того, чтобы иметь достаточно испытаний и приемлемое соотношение сигнал / шум, следующие суммы скидки: 1,5, 2,5, 3,5, 4,5 или 5,5 юаней и пожертвование 0 юаней считались чистой ценовой рекламой, в то время как 1 , 2, 3, 4 или 5 юаней и фиксированная скидка 0.Пожертвование в размере 5 юаней было проведено как смешанная акция.

Рисунок 1. Последовательность стимулов в каждом испытании. Эпохи извлекаются после появления рекламной информации.

Процедуры

Все элементы (всего девять) из шкалы импульсивности, утвержденной Рук и Фишер (1995), были решены для измерения импульсивности потребителя. Чтобы получить китайскую версию этих предметов, мы следовали процедуре перевода / обратного перевода Брислина (1980). Двое китайских докторантов, специализирующихся на поведении потребителей, перевели оригиналы на китайский язык соответственно.Два переводчика и авторы обсудили эти две версии вместе, чтобы разработать первоначальную анкету, которая впоследствии была переведена на английский язык двумя англоговорящими переводчиками, не знающими об импульсивности потребителя. Два профессора потребительского поведения и другие люди, упомянутые выше, проверили все переводы на предмет логической согласованности, контекстуальной релевантности и ясности для достижения консенсуса. Наконец, шкала была снова изменена, чтобы стать более четкой и понятной, на основе пилотного опроса 15 потребителей для получения отзывов по этим пунктам, и это была девятибалльная шкала (1 = категорически не согласен, 9 = полностью согласен).В соответствии с другими исследованиями гедонистического потребления (например, Okada, 2005; Ramanathan and Williams, 2007), медианное разделение делило участников на категории гедонистов ( N = 20, выше медианы) или благоразумных ( N = 20, ниже чем медиана) по шкале импульсивности (α = 0,91; медиана = 33,5). Чтобы уменьшить влияние спроса, которое шкала может иметь на ответы испытуемых, эти задания были выполнены за 1 месяц до эксперимента.

Участники сидели в удобных креслах в 80 см от 23-дюймового монитора (1360 × 768 пикселей, 60 Гц).Набор инструментов Psychophysics (Brainard, 1997) использовался для представления стимулов. Как показано на Рисунке 1, во время эксперимента цвет фона был серым, и испытуемые сначала подвергались фиксированному кресту в течение 1000 мс, предшествовавшему изображению закуски в течение 2000 мс. После пустого экрана 600–800 мс, информация о рекламной акции была представлена, включая две строки, одна из которых была «Пожертвование: 0,5 (или 0,0) юаня» или «Скидка: 1,0 (2,0, 3,0, 4,0, 5,0) (или 1,5, 2,5). , 3,5, 4,5, 5,5) юаней ». Тем временем участникам было предложено решить, покупать ли эту закуску по этому предложению, в течение 3000 мс.Нажатие «f» и «j» означало «покупать» и «не покупать» соответственно для половины участников, а для остальных — противоположная картина. Относительное положение условий пожертвований и скидок было уравновешено. Разница в глубине скидки для идентичного изображения оставалась 0,5 юаня, и каждая скидка назначалась каждому изображению случайным образом, но количество рекламной информации для каждой скидки было одинаковым. Всего 100 испытаний с двумя блоками были псевдослучайными, и все условия продвижения для каждого продукта не появлялись в двух последовательных испытаниях каждого блока.

Перед экспериментом испытуемым сообщили, что первоначальная цена всех продуктов составляла 10 юаней (примерно 1,42 доллара). Каждый раз, когда они принимали решение о покупке, участники виртуально получали 30 юаней (примерно 4,25 доллара). Чтобы лучше смоделировать контекст покупок, мы бы выбирали продукт случайным образом из предметов, участники предложения которых приобрели во время эксперимента, чтобы «продать» их. Субъекты, наконец, могли получить этот продукт и «денежную экономию» (30 юаней минус текущая цена продукта), а для смешанной рекламы они также пожертвовали 0.5 юаней в пользу проекта «Надежда», который является хорошим делом в Китае и планирует помочь молодежи из неблагополучных районов. Следуя Schaefer et al. (2016), была актуализирована карательная мера за потенциальные наклонности, при которых испытуемые могли просто купить несколько вещей. Если количество условий, при которых участники будут покупать гедонистические товары, будет меньше 10, они потеряют 9 юаней. Если бы число было где-то в диапазоне от 10 до 12, они потеряли бы 6 юаней, а если бы где-то в диапазоне от 13 до 15, они потеряли бы 3 юаня.Участники не потеряли бы никаких денежных средств, если бы сумма была> 15.

Записи и анализ поведения

поведенческих записей были созданы отдельно для четырех экспериментальных условий в смешанном дизайне 2 (тип продвижения: смешанный против чистого, внутрисубъектный фактор) × 2 (импульсивность: импульсивный против осторожного, межсубъектный фактор). Скорость покупки и время реакции регистрировали с помощью Psychophysics Toolbox (Brainard, 1997). Скорость покупки каждого предмета относится к пропорции предметов, выбранных для покупки.Время реакции относится к временному отрезку от времени представления информации о продвижении до принятия окончательного решения. Для поведенческих данных проводили многократно измеряемый дисперсионный анализ (ANOVA).

Запись и анализ ЭЭГ

ЭЭГ кожи головы каждого субъекта регистрировали с помощью усилителя Brain actiCHamp (Brain Products GmbH, Мюнхен, Германия) и с 64 электродов Ag / AgCl с частотой дискретизации 500 Гц в колпачке. Импеданс поддерживался ниже 10 кОм, и данные фильтровались онлайн при 0.Полосы пропускания 05–100 Гц. Записи были привязаны онлайн к сайту Cz, а среднее значение левого и правого сосцевидного отростка служило автономной ссылкой. Для измерения электроокулограммы использовали электроды, размещенные над глазницей и внутри глазницы по отношению к обоим глазам и латеральнее наружного угла угла глазной щели обоих глаз. BrainVision Analyzer 2.1 (Brain Products) был выбран для предварительной обработки данных ЭЭГ, отфильтрованных в автономном режиме с помощью фильтра нижних частот с частотой 30 Гц, а эпохи были извлечены между 200 мс до начала и 800 мс после появления информации о продвижении.Эпохи с отклонением, превышающим ± 100 мкВ, отбрасывались, а движения глаз корректировались с использованием алгоритма Gratton et al. (1983).

На основе форм больших средних значений и некоторых литературных источников по потребительской нейробиологии (Wang et al., 2016; Goto et al., 2017; Jing et al., 2019), F3, Fz и F4, как фронтальный кластер, были выбраны для N2, измеренного по средней амплитуде временного окна 270–330 мс соответственно. Аналогичным образом временное окно 400-800 мс было проанализировано для FNSW, включая F3, Fz и F4, как фронтальный кластер (Matsuda and Nittono, 2015b, 2018a).Для данных ERP были выполнены многократно измеряемые дисперсионные анализы (ANOVA). Был проведен корреляционный анализ Спирмена между амплитудой N2 и временем реакции, а также амплитудой N2 и скоростью покупки.

Результаты

Поведенческие результаты

ANOVA-анализ 2 (тип продвижения: чистое против смешанного, фактор внутри субъектов) × 2 (черта потребителя: импульсивные или осторожные потребители, фактор между субъектами) был проведен для скорости покупки и времени реакции, соответственно.Основной эффект от типа промоакции был значительным в количестве покупок [ F ( 1 , 38 ) = 4,290, p = 0,045, ηp2 = 0,101], а также времени реакции [ F ( 1 , 38 ) = 8,725, p = 0,005, ηp2 = 0,187]. Как показано на рисунке 2, коэффициент покупок в условиях смешанной рекламной акции (Среднее = 0,607, SE = 0,026) был выше, чем в условиях чистой рекламной акции (Среднее = 0.537, SE = 0,030). Напротив, время реакции в условиях смешанного продвижения (Среднее = 1173,670 мс, SE = 62,144) было больше, чем время реакции в условиях чистого продвижения (Среднее = 1115,670 мс, SE = 55,283). Другие эффекты для скорости покупки ( F с <0,14, p с> 0,71) или времени реакции ( F с <0,30, p с> 0,58) не имели значения.

Рисунок 2. Поведенческие результаты. Скорость покупки (A) и время реакции (B) для каждого условия, а также скорость покупки каждой суммы скидки в условиях смешанной акции и чистой акции, соответственно.Планки погрешностей предполагают стандартную ошибку среднего. p <0,05, ∗∗ p <0,01.

Результаты ERP

N2 и FNSW были соответственно собраны в ANOVA 2 (тип продвижения) × 2 (потребительский признак). ANOVA N2 выявил существенное влияние на тип продвижения [ F ( 1 , 38 ) = 4,467, p = 0,041, ηp2 = 0,105], но не в потребительских качествах. [ F ( 1 , 38 ) = 2.636, p. = 0,113]. Рисунок 3 показывает, что была обнаружена большая амплитуда N2 в смешанном промотировании (Среднее = -3,148 мкВ, SE = 0,490), чем в чистом промотировании (Среднее = -2,709 мкВ, SE = 0,509). Эффект взаимодействия между типами продвижения и не имел значения [ F ( 1 , 38 ) = 0,008, p = 0,928]. Корреляционный анализ Спирмена показал, что амплитуда N2 на F4 ( r = -0,266, p <0.05) отрицательно влияет на время реакции, а на F3 ( r = 0,248, p <0,05) положительно влияет на скорость покупки.

Рис. 3. Грандиозные усредненные формы сигналов ERP (слева) для каждого условия, собранные по электродам F3, Fz и F4. Справа — разностные карты (400–800 мс).

Результат FNSW оказал значительное влияние на потребительские свойства [ F ( 1 , 38 ) = 4.163, p = 0,048, ηp2 = 0,099], который отличается от типа продвижения [ F ( 1 , 38 ) = 0,282, p = 0,598]. Как показано на Рисунке 3, у импульсных потребителей (Среднее = -3,225 мкВ, SE = 0,765) выявлено более высокое значение FNSW, чем у разумных (Среднее = -1,017 мкВ, SE = 0,765). Эффект взаимодействия для типа продвижения и снисходительности оказался несущественным [ F ( 1 , 38 ) = 0.589, p. = 0,448].

Обсуждение

Основная суть этого исследования состоит в том, чтобы изучить FNSW, который возникает у потребителей во время их покупки гедонистических товаров, помимо CIT, и выявить психологический процесс, имеющий отношение к FNSW. Кроме того, мы также учитываем скорость покупки, время реакции и компонент N2, чтобы увеличить обоснованность объяснения FNSW в настоящем исследовании.

Как и ожидалось, у импульсивных людей была вызвана более высокая амплитуда FNSW, чем у разумных.Поскольку FNSW отражает подавление реакции на информацию о преступности (Matsuda and Nittono, 2015b, 2018a), можно предположить, что FNSW (400-800 мс) не только связано с предпочтениями потребителей (Goto et al., 2017) , но также это может отражать процесс подавления реакции на некоторую информацию в контексте принятия решения о покупке. Продвижение как общая маркетинговая стратегия может эффективно стимулировать спрос на гедонистические продукты (Kivetz and Zheng, 2017). В этом эксперименте, получив различную рекламную информацию, импульсивные потребители, как правило, контролировали свое рвение к покупке гедонистических товаров (Wertenbroch, 1998), и они предпочитали подавлять реакцию на рекламную информацию, что приводило к увеличению FNSW по сравнению с осмотрительными потребителями.В CIT испытуемых просят сохранять такую ​​же мозговую активность для криминальных предметов, как и для других предметов. Однако настоящий эксперимент не требовал от участников намеренного подавления своего желания и реакции. FNSW в этом исследовании может отражать торможение, основанное на спонтанном и усложняющем процессе.

В качестве дополнительного вывода мы наблюдали значительно более высокий уровень покупок при смешанной рекламной акции (сочетание скидки и благотворительного пожертвования), чем при чистой ценовой рекламной акции.Хотя пожертвования на благотворительность имеют такой же эффект в продвижении гедонистической покупки, как и продвижение цен, была обнаружена положительная синергия между продвижением цен и продвижением на основе пожертвований, и потребители предпочли гедонистические продукты с комбинированным предложением скидки и пожертвования. Кроме того, не было значительного основного влияния импульсивности и эффекта взаимодействия на скорость покупки. Влияние двух типов поощрения на ослабление внутриличностного конфликта из-за того, что гедонистическое потребление не удовлетворяет основные потребности, может быть одинаковым для импульсивных и расчетливых потребителей.Поскольку предпочтения в отношении рекламных акций между этими двумя группами потребителей существенно не различаются, эти результаты также служат косвенным доказательством, чтобы исключить альтернативное объяснение того, что разница в FNSW является результатом субъективных предпочтений.

Что касается времени реакции, мы получили большее время реакции в смешанном промотировании. Время реакции связано с трудностью задания и когнитивной нагрузкой (Sweller, 1988; Cowen et al., 2002). Потребители легко принимали окончательное решение в условиях смешанного продвижения, тогда как они прилагали дополнительные когнитивные усилия в условиях ценового продвижения.Мы утверждаем, что причина более быстрой реакции на ценовое продвижение, чем на смешанное продвижение, заключается в том, что во время эксперимента принимается решение, как не покупать. Поскольку намерение совершить покупку выше в условиях смешанной рекламной акции, труднее найти отрицательную информацию, чтобы отклонить покупку. Фактически, результаты N2 могут подтвердить этот аргумент.

Наше исследование показало нам существенный главный эффект от типа продвижения для компонента N2. Исследования потребительской нейробиологии показали, что этот компонент положительно связан с конфликтом восприятия (например,г., Wang et al., 2016; Jing et al., 2019). Результат для N2 подтвердил аргумент о времени реакции. Как показали результаты оценки количества покупок, потребители предпочитают сочетание скидки и благотворительного пожертвования. Хотя смешанное продвижение имеет более положительное влияние на разрешение конфликта, заключающегося в том, что гедонистическое потребление не является необходимым для нашей повседневной жизни, шаблон решения состоит в том, чтобы отклонить гедонистические продукты с некоторым предложением. Таким образом, в ходе этого эксперимента участники ожидали, что в качестве отклоненного варианта выберут чистое ценовое продвижение.Когда было представлено смешанное продвижение, возник конфликт ожидания и, таким образом, возникла повышенная амплитуда N2. Более того, этот компонент N2, отражающий обработку рекламной информации, предоставляет нейрофизиологические доказательства для объяснения FNSW в контексте гедонистических покупок. В частности, хотя мы утверждаем, что FNSW имеет отношение к подавлению стремления к гедонистическому потреблению, одно альтернативное объяснение состоит в том, что по сравнению с осмотрительными потребителями у импульсивных потребителей повышается мотивационное взаимодействие с рекламной информацией, и, таким образом, появляется более высокий FNSW.Однако результат N2 показал, что участники были мотивированы отказаться от продуктов с ценовым предложением по продвижению, то есть мотивационное взаимодействие с покупкой на основе рекламных акций может быть отражено в компоненте N2. Напротив, предпочтение потребителей к промоакциям не отражалось в FNSW (незначительный основной эффект от типа промоакции). Таким образом, FNSW в настоящем исследовании специфичен для процесса мотивационного взаимодействия с торможением, а не с предпочтениями потребления.

Компоненты N2 и FNSW указывают на двухступенчатую схему.Во-первых, независимо от импульсивных и осмотрительных потребителей, они должны полагаться на восприятие, опыт и понимание, когда они решают, покупать ли гедонистические товары или нет в течение своего обычного повседневного существования. Как показывает результат N2, модель принятия решения о том, как не покупать, побуждает потребителей ожидать худшего предложения, соответствующего продуктам. После того, как они указали свои предпочтения, импульсивные потребители должны подавлять физиологические реакции на рекламную информацию, но, как показывает результат FNSW, этого не происходит с осторожными потребителями.Этот паттерн аналогичен психологическим конструкциям системы поведенческой активации (BAS) и поведенческой системы торможения (BIS). BAS отражает подход к положительным стимулам и чувствителен к сигналам вознаграждения и ненаказания, а BIS чувствителен к сигналам наказания и отсутствия вознаграждения и подавляет поведение, которое может привести к отрицательным результатам (Gray, 1981, 1982). Тип продвижения и импульсивность могут быть связаны с BAS и BIS соответственно. Когда была представлена ​​рекламная информация, сначала была активирована BAS.Целью потребителей было отклонить худшее предложение. Таким образом, большая активация BAS в условиях чистого поощрения цены побуждает субъектов увеличивать движение к цели. Во-вторых, активность в BIS вызывает у импульсивных потребителей торможение движения к цели, то есть подавление реакции на рекламную информацию.

Последствия

Возможности, связанные с событиями, в качестве неинвазивной технологии могут открыть окно в мозговую активность потребителя и, таким образом, произвести иную интерпретацию поведения потребителя по сравнению с использованием поведенческих подходов.Участники выражают предпочтение смешанной рекламе, независимо от импульсивности, в то же время они ожидают отказа от чистой рекламы. Однако импульсивные потребители производят более крупную FNSW и подавляют желание совершить покупку, что затрудняет сопоставление с текущими поведенческими результатами, такими как скорость покупки и время реакции. Различие компонента N2 между типами продвижения помогает маркетологам лучше понять отношение потребителей к покупкам. Исследователи также должны сосредоточиться на том, что FNSW может быть получено только с помощью метода ERP.Подавление возбуждения, которое представляет собой FNSW, иногда невозможно обнаружить в контексте гедонистических покупок, особенно когда подавление не определяет принятие окончательных решений. Гедоническое потребление вызывает чувственное удовольствие, фантазию, веселье и чувство вины (Strahilevitz and Myers, 1998), и импульсивные потребители должны подавлять свои положительные и отрицательные эмоции, чтобы они могли часто потреблять гедонические элементы в будущем. Поскольку эмоциональный опыт потребителя может способствовать увеличению продаж (Gountas and Gountas, 2007), ERP следует рассматривать как эффективный инструмент и дополнение для маркетинговых исследователей, позволяющих глубже понять поведение при покупке гедонистами.

С другой стороны, следует обсудить значение FNSW для стимулирования продаж. Наши результаты показали, что рекламная информация не повлияла на амплитуду FNSW. Согласно схеме соответствия выгод эффективности стимулирования сбыта (Chandon et al., 2000), более высокий уровень покупок, обнаруженный в условиях смешанного продвижения, означает, что смешанное продвижение обеспечивает больше гедонистических выгод, чем чистое ценовое продвижение, и потребители придают больший вес гедонистическим выгодам. из продуктов.Но как мы можем связать акции с FNSW? И поскольку FNSW является специфическим компонентом потворства в контексте гедонистических покупок, как стимулирование продаж может работать на FNSW? Импульсивные потребители более склонны постоянно получать небольшую прибыль от гедонистического потребления (Wertenbroch, 1998). Следовательно, преимущества стратегий продвижения должны быть одинаковыми, например, скидка небольшая, но активность продолжается долгое время. Потребляя гедонистические товары с такими рекламными предложениями, импульсивные потребители получают удовольствие.Эффективность продвижения гедонистических покупок зависит от того, помогает ли стимулирование продаж импульсивным потребителям не подавлять свои порывы и потреблять с положительными эмоциями и без отрицательных эмоций. Поскольку подавление возбуждения характеризуется FNSW, а не другими данными, полученными с помощью поведенческого метода, специалистам по маркетингу необходимо уделять больше внимания тому, можно ли модулировать FNSW с помощью новых стратегий продвижения, нацеленных на импульсивных людей.

Ограничения и расширения

Matsuda и Nittono (2015a) показали, что затылочная доминантная LPP с фронтальной негативностью (FNSW) вызывалась релевантной для задачи картинкой не только в условии маскировки, но и в условии обновления из двух пунктов, в котором испытуемые должны обновлять и то, и другое. месяц и число, когда отображается соответствующая информация.Затылочная доминантная LPP может отражать требующую усилий и контролируемую обработку (Matsuda and Nittono, 2015a). Таким образом, в текущем эксперименте, поскольку импульсивные потребители должны подавлять свои желания, они могут участвовать в дополнительной обработке и потребовать больше когнитивных усилий, чем разумные потребители, что в конечном итоге приведет к увеличению FNSW. Другими словами, разницу FNSW между двумя группами можно объяснить когнитивной нагрузкой. Следует отметить, что субъекты должны быть принуждены действовать таким образом, чтобы вызвать FNSW в CIT, тогда как FNSW может исходить из неявного отношения к соответствующей информации.Импульсивные потребители обычно подавляют свой первоначальный импульс в повседневной жизни и могут прилагать те же познавательные усилия, что и расчетливые потребители. Логика аналогична логике некоторых исследований ERP об эффекте тренировки (например, Xiu et al., 2018; Pan et al., 2019). Например, в задаче арифметических вычислений испытуемые должны были судить, были ли предложенные решения арифметических задач правильными или нет, а задачи большего размера вызывали увеличение положительной амплитуды медленной волны, и, что более важно, положительная медленная волна уменьшалась после тренировки (Núñez- Пенья, 2008).Другими словами, на практике участники могли без усилий правильно решать арифметические задачи. На протяжении многих лет практика совершения покупок в различных условиях (аналогично обучению) путем осмоса побуждает людей формировать импульсивную или осмотрительную привычку совершать покупки. В текущем исследовании потребители, имеющие одну из этих двух привычек, прилагают одинаковые усилия к гедонистическим покупкам, хотя реакция их мозга может быть разной. Дальнейшие исследования должны быть сосредоточены на обучающем эффекте или обучающем эффекте, чтобы проверить процессы, отраженные FNSW в контексте гедонистических покупок.

Мотивы для сокрытия и раскрытия информации также можно рассматривать как потенциальное ограничение. В этом исследовании мы утверждаем, что импульсивные потребители, как правило, скрывают свое желание, когда получают информацию о рекламе. Тем не менее, некоторые источники, по-видимому, поддерживают другое объяснение. Поскольку гедонистические продукты не нужны для элементарного благополучия и расточительны, потребители, покупающие такие продукты, не соответствуют обществу, и они с большей вероятностью будут подвергаться критике (Baumeister, 1982; Böhm and Pfister, 1996) с чувством вины (Prelec and Lowenstein , 1998).Импульсивные потребители испытывают меньше негативных эмоций самосознания, которые возникают в результате усилий и вдумчивой обработки с течением времени, таких как вина, стыда и сожаления, чем благоразумные потребители после гедонистического потребления (Ramanathan and Williams, 2007). Критика со стороны общества не заставляет импульсивных потребителей чувствовать себя виноватыми. Можно предположить, что импульсивные потребители не подвержены влиянию социальных норм и склонны проявлять желание гедонистических покупок. Основываясь на текущем эксперименте, в будущих исследованиях можно будет изучить влияние социальной желательности гедонистической покупки.

В дополнение к анализу формы волны FNSW, мы выполнили анализ мощности глобального поля (GFP), чтобы исследовать другие временные события, связанные с фронтальной последовательностью стимулов (см. Дополнительные материалы). GFP — это мера глобальной активации мозга, рассчитываемая как среднеквадратичное значение сигнала ЭЭГ по всем электродам с более высокими значениями для более сильных электрических полей (Lehmann and Skrandies, 1980). Для каждого типа продвижения (ценовое продвижение и смешанное продвижение) мы применили точечный парный тест t , сравнивая значения GFP для импульсных ирасчетливые потребители с 10-балльным временным критерием значимости. Таким образом, мы рассмотрели первую временную точку (от 400 мс до 800 мс), где тест t был значимым (с критерием альфа 0,05) как минимум для 10 последовательных точек данных (т. Е. 20 мс при скорости оцифровки 500 Гц). . Таких последовательных точек данных не обнаружено. Существенная разница для FNSW, не связанная с глобальным изменением напряженности поля, указывает на локальную модуляцию фронтальных ответов. В будущих исследованиях потребительской нейробиологии анализ GFP может помочь исследователям получить больше информации для поддержки и расширения выводов.

Некоторые исследования показали, что пол связан с импульсивностью (например, Fu et al., 2007; Wu and Huan, 2010). Например, на основе большой неклинической выборки Grano et al. (2004) показали, что импульсивность может предсказать увеличение количества выкуриваемых сигарет в день у женщин, но не у мужчин. Мы проверили гендерный фактор в этом исследовании, но не выявили значительных эффектов ( F s <0,23, p s> 0,63). Одно стоящее расширение этой работы могло бы сосредоточиться на других продуктах, таких как сигареты и алкоголь, которые часто изучались на предмет импульсивности, или на других причинах, оправдывающих гедонистическое потребление, таких как дарение подарков, в которых гендер имеет влияние (например,г., Ашвин и др., 2013).

В этом исследовании мы использовали парадигму S1 – S2, которая часто используется в исследованиях потребительской нейробиологии, для изучения эффектов типа продвижения и импульсивности. Однако в исследованиях CIT обычно использовалась странная парадигма. В будущих исследованиях можно использовать странную парадигму, чтобы предоставить более прямые доказательства в поддержку идеи о том, что FNSW отражает процесс подавления реакции на рекламную информацию при принятии гедонистических решений о покупке. И мы также можем использовать странную парадигму, чтобы исследовать, может ли другой компонент ERP, появившийся в CIT, такой как P3, быть связан с поведением потребителей.

Заключение

В задаче виртуальной гедонической покупки подавление возбуждения обозначается FNSW (400–800 мс). В отличие от благоразумных испытуемых, импульсивные потребители подавляли реакции своего мозга на все типы продвижения, что было показано в более крупном FNSW, а большая амплитуда N2 в условиях смешанного продвижения предполагала, что потребители могут пойти на многое, чтобы найти негативную информацию о продвижении, чтобы отклонить покупку. .

Заявление о доступности данных

Необработанные данные, подтверждающие выводы этой статьи, будут предоставлены авторами без излишних оговорок.

Заявление об этике

Исследования с участием людей были рассмотрены и одобрены Внутренним наблюдательным советом лаборатории когнитивной нейробиологии Университета Яншань. Участники предоставили письменное информированное согласие на участие в этом исследовании.

Взносы авторов

YM, KJ, LC и RS задумали и разработали эксперимент. YM, KJ и LC провели эксперимент. YM и RS проанализировали данные. YM, KJ и ZS написали и отредактировали рукопись.Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Эта работа была поддержана Фондом гуманитарных и социальных наук Министерства образования Китая (номера грантов 18YJAZH079 и 20YJC860027), Фондом социальных наук провинции Хэбэй (номер гранта HB19XW003) и Проектом развития социальных наук провинции Хэбэй (номер гранта 20105003). ).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fnhum.2021.674312/full#supplementary-material

Список литературы

Ашвин, С., Тартаковская, И., Ильина, М., Лыткина, Т. (2013). ГЕНДЕРНАЯ ВЗАИМНОСТЬ: решение загадки невзаимности. Gender Soc. 27, 396–421. DOI: 10.1177 / 08213479444

CrossRef Полный текст | Google Scholar

Баумейстер, Р.Ф. (1982). Самопрезентабельный взгляд на социальные явления. Psychol. Бык. 91, 3–26. DOI: 10.1037 / 00332909.91.1.3

CrossRef Полный текст | Google Scholar

Бём, Г., и Пфистер, Х. Р. (1996). Инструментальные или эмоциональные оценки: что определяет предпочтения? Acta Psychol. 93, 135–148. DOI: 10.1016 / 00016918 (96) 000170

CrossRef Полный текст | Google Scholar

Брислин, Р. У. (1980). «Перевод и анализ содержания устных и письменных материалов», в справочнике по кросс-культурной психологии , ред.К. Триандис и Дж. У. Берри (Бостон, Массачусетс: Allyn & Bacon), 389–444.

Google Scholar

Коуэн Л., Болл Л. Дж. И Делин Дж. (2002). «Анализ движения глаз для удобства использования веб-страницы», в People and Computers XVI — Memorable Again Invisible , ред. X. Фолкнер, Дж. Финли и Ф. Детьен (Лондон: Springer), 317–335. DOI: 10.1007 / 978-1-4471-0105-5_19

CrossRef Полный текст | Google Scholar

Фаул, Ф., Эрдфельдер, Э., Бюхнер, А., и Ланг, А.Г. (2009). Статистический анализ мощности с использованием G Power 3.1: тесты для корреляционного и регрессионного анализа. Behav. Res. Методы 41, 1149–1160. DOI: 10.3758 / BRM.41.4.1149

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фолштейн, Дж. Р., и Ван Петтен, К. (2008). Влияние когнитивного контроля и несоответствия на компонент N2 ERP: обзор. Психофизиология 45, 152–171. DOI: 10.1111 / j.1469-8986.2007.00602.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фу, А., Ко, Х., Ву, Дж., Чернг, Б., и Ченг, К. (2007). Импульсивность и ожидание риска употребления алкоголя: сравнение студентов мужского и женского пола колледжей на Тайване. Наркоман. Behav. 32, 1887–1896. DOI: 10.1016 / j.addbeh.2007.01.003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Геймер М. (2011). «Обнаружение скрытой информации с использованием автономных методов», в Обнаружение памяти: теория и применение теста скрытой информации , ред. Б. Вершуере, Г.Бен-Шахар и Э. Мейер (Кембридж: издательство Кембриджского университета), 27–45. DOI: 10.1017 / cbo9780511975196.003

CrossRef Полный текст | Google Scholar

Goto, N., Mushtaq, F., Shee, D., Lim, X. L., Mortazavi, M., Watabe, M., et al. (2017). Нейронные сигналы избирательного внимания модулируются субъективными предпочтениями и решениями о покупке в задаче виртуального шоппинга. Biol. Psychol. 128, 11–20. DOI: 10.1016 / j.biopsycho.2017.06.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гунтас, Дж., и Gountas, S. (2007). Личностные ориентации, эмоциональные состояния, удовлетворенность клиентов и намерение совершить повторную покупку. J. Bus. Res. 60, 72–75. DOI: 10.1016 / j.jbusres.2006.08.007

CrossRef Полный текст | Google Scholar

Грано, М., Виртанен, М., Вахтера, Дж., Эловайнио, М., и Кивимаки, М. (2004). Импульсивность как предиктор курения и употребления алкоголя. чел. Индивидуальный. Отличаются. 37, 1693–1700. DOI: 10.1016 / j.paid.2004.03.004

CrossRef Полный текст | Google Scholar

Грэттон, Г., Коулз, М. Г. Х., и Дончин, Э. (1983). Новый метод автономного удаления глазного артефакта. Электроэнцефалогр. Clin. Neurophysiol. 55, 468–484. DOI: 10.1016 / 0013-4694 (83) -9

CrossRef Полный текст | Google Scholar

Грей, Дж. А. (1981). «Критика теории личности Айзенка», в A Model for Personality , ed. Х. Й. Айзенк (Берлин: Springer-Verlag), 246–276.

Google Scholar

Грей, Дж. А. (1982). Нейропсихология тревоги: исследование функций системы септо-гиппокампа. Нью-Йорк, Нью-Йорк: Издательство Оксфордского университета.

Google Scholar

Цзин, К., Мэй, Ю., Сун, З., Ван, Х., и Ши, Р. (2019). Как ценовые и количественные рекламные акции влияют на гедонистические покупки? Исследование ERP. Фронт. Neurosci. 13: 526. DOI: 10.3389 / fnins.2019.00526

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кивец, Р., Чжэн, Ю. (2017). Влияние рекламных акций на гедонистические и утилитарные покупки. J. Consumer Psychol. 27, 59–68. DOI: 10.1016 / j.jcps.2016.05.005

CrossRef Полный текст | Google Scholar

Lacetera, N., и Macis, M. (2010). Все ли материальные стимулы к просоциальной деятельности имеют обратный эффект? Ответ на денежные и безналичные стимулы для сдачи крови. J. Econ. Psychol. 31, 738–748. DOI: 10.1016 / j.joep.2010.05.007

CrossRef Полный текст | Google Scholar

Ландри, К. Э., Ланге, А., Лист, Дж. А., Прайс, М. К., Рупп, Н. Г. (2010). Донор в руке лучше, чем два в кустах? Свидетельства натурного полевого эксперимента. Am. Экон. Ред. 100, 958–983. DOI: 10.1257 / aer.100.3.958

CrossRef Полный текст | Google Scholar

Lehmann, D., and Skrandies, W. (1980). Безреференсная идентификация компонентов многоканальных потенциальных полей, вызванных шахматной доской. Электроэнцефалогр. Clin. Neurophysiol. 48, 609–621. DOI: 10.1016 / 0013-4694 (80) -8

CrossRef Полный текст | Google Scholar

Лу Дж., Лю З. и Фанг З. (2016). Гедонические продукты для вас, утилитарные продукты для меня. Принятие судебного решения 11, 332–341.

Google Scholar

Ма, К., Ван, X., Дай, С., и Шу, Л. (2007). Событийный потенциал N270 коррелирует с расширением бренда. Нейроотчет 18, 1031–1034. DOI: 10.1097 / WNR0b013e3281667d59

CrossRef Полный текст | Google Scholar

Мацуда И., Ниттоно Х. (2015b). Намерение скрыть активирует правую префронтальную кору: исследование потенциала, связанного с событием. Neuroreport 26, 223–227.DOI: 10.1097 / WNR.0000000000000332

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мацуда И., Ниттоно Х. (2015a). Мотивационная значимость и когнитивные усилия вызывают различные поздние положительные потенциалы. Clin. Neurophysiol. 126, 304–313. DOI: 10.1016 / j.clinph.2014.05.030

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мацуда И. и Ниттоно Х. (2018b). «Психологические реакции в тесте на скрытую информацию: выборочный обзор в свете распознавания и сокрытия», в Выявление скрытой информации и обмана: вербальные, поведенческие и биологические методы , изд.Дж. П. Розенфельд (Сан-Диего, Калифорния: Elsevier / Academic Press).

Google Scholar

Мацуда И. и Ниттоно Х. (2018a). Специфическая для маскировки фронтальная отрицательная медленная волна генерируется из правой префронтальной коры в тесте на скрытую информацию. Biol. Psychol. 135, 194–203. DOI: 10.1016 / j.biopsycho.2018.04.002

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нуньес-Пенья, М. И. (2008). Влияние тренировки на арифметический эффект размера задачи: исследование потенциала, связанного с событием. Exp. Brain Res. 190, 105–110. DOI: 10.1007 / s00221-008-1501-y

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пан Д., Ван Ю., Лей З., Ван Ю. и Ли X. (2019). Измененные ранние компоненты и решающий последующий процесс, лежащий в основе модификации предвзятости внимания при социальной тревоге: данные из связанных с событием потенциалов. Soc. Cogn. Оказывать воздействие. Neurosci. 14, 1307–1316. DOI: 10.1093 / сканирование / nsz098

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Раманатан, С., и Уильямс, П. (2007). Непосредственные и отсроченные эмоциональные последствия потакания: сдерживающее влияние типа личности на смешанные эмоции. J. Consumer Res. 34, 212–223. DOI: 10.1086 / 519149

CrossRef Полный текст | Google Scholar

Рук, Д. У., и Фишер, Р. Дж. (1995). Нормативные воздействия на импульсивное покупательское поведение. J. Consumer Res. 22, 305–313. DOI: 10.1086 / 209452

CrossRef Полный текст | Google Scholar

Шефер, А., Буратто, Л. Г., Гото, Н., и Братство, Э. В. (2016). Отрицательность, связанная с обратной связью, и потенциал мозга P300 чувствительны к нарушениям ожидаемых цен в задаче виртуального шоппинга. PLoS One 11: e0163150. DOI: 10.1371 / journal.pone.0163150

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Страхилевиц М. и Майерс Дж. Г. (1998). Пожертвования на благотворительность в качестве стимула к покупке: насколько хорошо они работают, может зависеть от того, что вы пытаетесь продать. Дж.Consumer Res. 24, 434–446. DOI: 10.1086 / 209519

CrossRef Полный текст | Google Scholar

Свеллер Дж. (1988). Когнитивная нагрузка при решении задач: влияние на обучение. Cogn. Sci. 12, 257–285. DOI: 10.1207 / s15516709cog1202_4

CrossRef Полный текст | Google Scholar

Вершуере, Б., Розенфельд, Дж. П., Виноград, М. Р., Лабковский, Э., и Виерсема, Р. (2011). Роль обмана в обнаружении памяти P300. Legal Criminol. Psychol. 14, 253–262. DOI: 10.1348 / 135532508X384184

CrossRef Полный текст | Google Scholar

Ван, К., Мэн, Л., Лю, М., Ван, К., и Ма, К. (2016). Как социальные сигналы влияют на решения потребителей о покупках в Интернете? Исследование потенциала, связанного с событием. Electronic Commerce Res. 16, 1–26. DOI: 10.1007 / s10660-015-9209-0

CrossRef Полный текст | Google Scholar

Wu, W., and Huan, T. (2010). Влияние покупательской ситуации и конформного поведения на импульсивные покупки молодых студентов. Afr. J. Bus. Управлять. 4, 3530–3540.

Google Scholar

Чжан, В., Цзинь, Дж., Ван, А., Ма, К., и Ю, Х. (2019). Неявная мотивация потребителей к покупке люксовых брендов: исследование ЭЭГ. Psychol. Res. Behav. Управлять. 12, 913–929. DOI: 10.2147 / PRBM.S215751

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Russian-Records.com> Поиск> очень

Кат. №
(Mx / Ctr No.)
Take Название Название (Композитор) Артисты, аккомпанемент Дата записи
Место записи
Этикетка [xRef №
] №]
Файлы
RX-5503-A Edmonton Easy Aces, Conductor () ~ 1955
RX-31 -506A 1948
-, ()
AR-506
30635 22 422
9328 5031 9022
. , Кондуктор 15 15 4 9022
449-L 1926.1929 (?)
— (?)
() 449-L
68422-A
(2628c)
01-05-1912 (,) 68422
5045
(312½z)
, в соотв. .. () (,) 1902
.-
()
.
23121
(287x)
, в соотв. 1901
.-
23143
(461x)
— () (9022, текст:
.., в соотв. 1901
.-
()
2-23006
(3000L)
(), в соотв. .,. () 1905
()
22436
(3011)
— (, текст 2) ( 🙂
, в соотв. 1901
.-
2-23015
(3102L)
., В соотв. . () 1905
()
2-23739
(4019ae)
., В соотв. 19-11-1912
i P65
2-20716
(4824ae)
122, проводник .. 25-08-1913
222 i
3-22918
(8641L)
, в соотв. 01-02-1909
()
2-24833
(17463b)
. . , Кондуктор i 158
2-242701
(18088 b)
, в соотв. 1913 i P 492
4-24587
(18575b)
, в соотв. , Проводник ϸ, Соло от ϸ 10-12-1913
i 393
751 , в соотв., Кондуктор 21-04-1934
317
1905
04020 4 91 (текст) (), на основе::)
, в соотв. , Кондуктор 1936
400
50
4077 , Кондуктор, Соло по 1936
5031 9022 1941
-31
31
12658 .. () 1945
1100
13937 , в соотв. -, Кондуктор 1946
15331 , в соотв. , Кондуктор 1947 630/47
16479 , в соотв. .. () 1948 812
19675 ϸ, в соотв., Кондуктор 1951
000000
(000000-1)
. . (?), соотв. ~ 1950
Wilcox-Gay
X-63566
(3000L)
(), в соотв. .,. () 1905
Международный Зонофон
X-63771
(4938L)
(.), в соотв. 1906
14715 (), в соотв. .,. () 1905
()
i
JB 331
(OHR 549)
, в соотв. , Кондуктор Columbia ()
1 JB 331
7680-M
(XCO 37486)

1 ​​

4 Master 912umb MM 972-6
ZP 7
(XZ 1014)
Doppelquartett des T.В. Ноймюнстер — Двойной квартет Цюрихского гимнастического клуба ~ 1950
Цюрих
Колумбия ()
— «» «»
1252 912
1954
«»
087 , в соотв. , Проводник (3-)
(1-)
1568 # 1 , в соотв. 1938
(1-,) 2459
# 2 , в соотв. 2454
1570 # 1 , в соотв. — 1938
(1-,) 2456
# 2 , в соотв. () 2455
,
0023632 ϸ, в соотв., Кондуктор 1951
1954
— «»
— 432 -, в соотв. 1929
() 18632

(ND3-MC-3332)
«», в соотв. 16-07-1943
M 7
A 207527 a
(Ro 1202)
, в соотв. ,. (,) A 207527
40175
(24411A)
, в соотв. 31-12-1910
76435
(2014c)
Ը, в соотв. 29-08-1910
472
9123 Проводник ~ 1914
() 023
()
3898
(W 140713)
, Проводник (?) () 3898
20475 , в соотв.() 10-1929 … 03-1930 3388
2-20716
(4824ae)
122, проводник ..-08 -1913
. P272
3-A
(C-I-3-A)
, в соотв. , Проводник () ~ 1952
3
21615 129 129, Проводник —
9

127 натрий доказано проблема помогать поставлен скромный творческий взятый агонист ограничение нагрузка сульфат обслуживать 463 Ньюпорт точно abeta42 вакцины CERAD серый галимберти изобретатель участник 3051 нейробиология молекула психиатрия MPL показано порог 1630 спектрофотометрия AA региональный проверено уменьшать синтетический головной мозг Джеффри Schluesener учился Locati 153 Вестерман Perkinelmer 101 311 8850 деятельность Баркгоф атипичный жидкость надзиратель присутствие диаз гистология KE незначительный тролль впрыснутый благодарить стр70 тип вскрытие гистохимия невровоспаление фат оценивать кузнец 2002 г. супернатант 486 Guilarte гиппокамп природа поддержанный одновременно Маккей глобу там индикат евро подросток S1 загружен радиоактивный индикатор Heslin caggacgtcaaagcactgaa шнур подходящее темп западный иметь значение Монтгомери ферон сосудистый Има 3241 плотность люди идентифицировать источник Fraser Сибрук получение вэй Зигель местный исход глицеральдегид синтаза маркировка Информация дель Stauffer Питер различный Верли напрямую 0001 количество Murdoch2 изображенный Перес фракционирование JL читатель поликлональный 1084 бретт солонка3 ювентус отмечен unles 116 подтвержденный меж натренированный немного миллипор кому Qiagen невритический Показать Муцину ELISA сокращение измеримый задний ход недостаток цена 001 микропланшет Kloet бош байер даже внутричерепной ltd 7303 ND межквартильный 1991 г. убхи брана Я ДЕЛАЮ немедленно Hoge принятие APOE Neisseria Картье самолет Честер чандер jouanny рассчитанный альтернатива лос dct брак преимущественно Ронал применение количественная оценка биорад Herndler бар TOI безумный TJ TLR Тричел интерес Venneti мозговой часто томография upmc окончательный токсикол Дики необратимый 468 HB взращивать биомаркер панель островной инкубированный фосфат кайед наука 349 уже клинический кортикальный слой ΔAβ42 должным образом последующий СМ погруженный строить разбавленный Танемура 1383 137 Beierschmitt додецил 15213 TF поставлен диагноз SJ савада известный гиман составление не понятно манноза дополнительный гомер значительный паренхима Моро реестр Парнетти vivo город боковой Brayne человек переписка ммоль DE YKL грунтовка3 fcrgamma липид PS слабоумие перрин стол Weiskopf распознавать погружение горка 6513 молоко зеленый неоднородный Миттельброн 526 фигура 108 604 бисер аккредитация MQ OD неврологический CHI3L1 нейронный гематоксилин 232 477 велла логика результат гранулемату ключевое слово ЭМ 142 биология логия решение часть груз альфа отражающий ученик Доктор медицины иммуноген растворенный ва установленный настоящий доклинический исключительно фогель биохимический правительство деталь ДЖО CCR3 хемилюминесценция окрашенный гуморальный биотек ET Мэлоун Кирби DL необходимость плавильщик белый захватывать количественно мог выражение айсберг Рахими нейровирол Wilmington панический предлагая порт интервал выполненный меньше 6335 Quidel лаборатория пассивный обучение антитело плазминоген исследовать дай молодой Sourceforge учитывая шахиди способствовать xiong 1562 aagctccaggatgaaaccaa дитиотреитол гель aaggaaaccatggacaatgc PDGF активатор Прокарта BD указал различение садеги Schuitemaker ценить оба применимый лицензиат заблокирован превосходить в итоге карбона несмотря на то что период мужчина Мэтью Старый пышность ЖУРНАЛ вакцина rev ядерный олигомер сравнение орех девочка кюва Rockland все M1 сигма GC 68ga68ge нейро пик фо AE рассеченный гранула 2006 г. технология TNF Галлахер бы управляемый нанокапля грунтовка 20oc красный растворитель SE пасти существенно общий 184 концентра амилоид внутривенно MCI разработка ireton пентамер ограничение служба поддержки Рассел 181 Ghareghani Разместить многословный фактор мощный макака включая контроль Глобальный стимулирующий Weinberger CW08 Диксон рекомендация гиппокамп WR Calbiochem нац 554 в третьих содержание JE Хэнкок контралатеральный плотный сахароза подчинение честность в основном сборка дефицит 440 Арлин пятно патология маб саббаг JF gccctcgcttatgatctgtc болезнь Schwarz Адели чернить Уитни ухудшать mgcl2 отрицательный Бостон древесина прошел Саски MIP CG значительный томографический ниже включая в течение размытый замороженный жадность ПТГС2 Lesne вероятный несколько подход эффективность Розенталь болезнь Альцгеймера Чжибин VA отсутствие Цюрих аппарат Техедор 222 контрастное окрашивание посоветовать профилактика входить радиология вазогенный разрешающая способность системный близко возраст смерть таравне манн соотносить CCL4 объем выше 132 фургон биосистема распределен рог поздно ANOVA Остин 537 совместное администрирование invitro хранится порезанный 1007 родственник 1186 динамичный атрибуция строго открытым существенный расширенный величина Танигава регидратированный площадь принимала участие ва характеристика MH071151 Gilbertsville чишти содержал CA включение существовать ученый 908 LM Правильно приписанный в качестве альтернативы ослабленный 903 лосось разработан Шиммель 165 добыча Почта кубок сава естественный Grenfell индуцируемый нолте Brandtetter индуцированный FOV выпущенный сопрягать четыре Oни подострый JS нейрофибриллярный селективный жесты ингибитор менингитиди Дартиг неблагоприятный 6E10 обнаруживаемый FO Boellaard 117 марон Cruz затронутый MRC1 микро перевес опухоль Проверка 600 Юлия HJ удаление тракт индивидуальный минерализация сепа 457 La Jolla слабее весь кто переулок смешивание Mantovani организация область согласно брезолин фибробласт перфузированный ранее томический мозг глиальный симпатия плазма агрегирование цикл дифференциация повторно гомогенизированный WW 5333 NS пляж с косичками воспаление поставлен Гочикян 837 TR олигоабета показывая обильно предложить сотрудники выпускать пневмония соляной VOI производитель IB Iturbe ML Каллен исключать холм проанализированы циклооксигеназа Leerone JW суровый цинь Джонкер буферизованный совпадает забил плос CCR7 CD68 блокировка ожидал обработанный neu состоящий около 421 утро ведущий 1998 г. вакцина идаса базовый 8240 уген предварительно Нил киста водить машину синий МЧС альтернатива различать существенно 1514 Херукка получение легкое Доступ 408 субикулум белок RD Абрахамсон Элиэзер саквояж арка JM Дата смешанный медиана много Мартин значение ΔAβ шипение проверено тем не менее SDS Форстер mathis2 зубной налет под вязанка Hepe пожилой внутренний 7311 4717 желчный система месяц Ashe EE зарождающийся автор дробная часть 1553 Тай EK широко распространенный Массачусетт утилита CD3 инициированный каждый люминекс поддерживающий изолированные способ NC Стеатози не хватает диметил категоризированы модель 129 2145 4000 exp 1792 гепатити Кодама макрофаг добавление 168 Rockwell депарафинированный селкое риск серогруппа Leuven сан амино- уход Муниредди Мориц осталось алюминий скакательный сустав NM_001193925 представитель 1528 идентифицированный столбняк цитозольный сиг программное обеспечение 4oc 1972 г. быстро высоко медленный Loebenstein 743 FA ворота cttctctgcagcacatccat пациент PA Grubeck измеренный Бакскай scd40 возможность представлен выгода Jolla учиться 1040 приспособленный левин рука мягче JC оказывать воздействие не обнаруживать томограф вакцинированный 1012 количественный анализ травма, повреждение BL клубок 113 семья 152 плотник Калифорния кейс реализовано RJ флитман ответить пылесос мкмоль состав вонг разнообразие слабый Мортазави S36 Сингх Бег Лопрести ресурс наблюдение Гилман Серебряный в одиночестве маленький эффективно FEBS синаптотоксический сыворотка агрегат фокус клон провоспалительный RS о физиол 120 определенный осевой предвкушение 392 кальций ДОМАШНИЙ ПИТОМЕЦ связь Вишневский сосудистая сеть рулевой FS Иглесия мозжечок сложность ядовитый Тилльманн неврол сульфат амилоидоз Holt мертвых синтез вместе расследовать перокс полиовиру сфероид оригинал культура увеличивать счет разбросать мирра фенотип животное Симидзу обычный абсолютный 916 технический предыдущий 200 англичанин 525 JP Дои стержень встроенный тмин MN 2001 г. РНК отек безумный Техас опубликовано мониторинг тив Малкин улучшен возможный trichel4 Maier нейробиол ccagggatttacagggagga предотвратил gtaggcccacgaaacaaatg cagcacagtggacattctcg мааруф височно-теменный обогащение производная ECAT онлайн актин 1067 17а секретный призма томпкин Карловы Вары PO1AG025204 содержащий полу отзывчивость Ancel Мори 346 Grajeda изменчивость 6503 LPS DM железо конкурирующий легкий активный накапливать красавица связь цитокин NM_001032884 иммуногистохимия гистопато влияние параметрический очевидный Кавахара достигнуто случайный запустить муноз Ричмонд под контраст руководство хейман Хансен Люэр миниген денситометрический 483 энцефалиты пиб 372 грызун behre МЫ последовательность шейный покойный предположил быстро затухание наш отчетливый tgcrnd8 ранее определенный med задуманный липополисахарид ди обнаружение хаммуд Кайдаш добавлен коллекция Рамка нерв группа продвижение визуализированный ttcagctcagggatgacctt мышей раскрытый познавательный простота предоставлена модуляция большой токсичность удаленный принято ccatccatccaagcaaactt относительно действие дер свидетели метилбензидин 2отдел мати Крис ПРИВЕТ медицинский ядерный скоро 979 Имму разрешать 310 192 химический конец НЕЙРОВСПЫЛЕНИЕ приобретать объем памяти лечение напряжение соответствующие поляризация тщательный точность отделенный увеличение 543 Типл серьезно 4231 МВт длинный NN периваскулярный специфический классифицированный хитиназа Bonneh чем без определять скопу Campdera Aβ42 реагент мера грипп савва явление эффективный диаграмма рассеяния Петерсен отделение под наблюдением этилен gottschall 4дивизион Хеппнер папилломавиру CXCL10 центральный физиологический раствор 233 самбхара фокусно кувшин радиоактивный рассмотрение ttgctgccttgtctttctga Конецко Ceballo тион жизнь пятак теменный технология пробка бензодиазепин следить усилие несколько вишня TBS концентрировать 842 сила очищенный печатка Дональд Брайан Адам продольный CCL5 andreasen 2000 г. суперблок RH помощь концентрация опосредованный фаг Ишии изображение поколение Jantzen в основном едко выбрал промокание привести эффективные пластина подкорковый нейродегенеративный Ple исходный уровень мог бы порядок инъекция синьорелл gtggtggctctccttgtcat стрелка биография следующий сосочковый Дженкин данные титр оно Миннеаполи стабильный механизм 131 Siemen транскрипционный соответствующий после индукция Тран интратекальный 355 обсуждение стратег иммуногенность назад Мовсесян воды некрозы количественный фатаза неоднородный 2005 г. консервированный умеренный по-разному радиолиганд Grundman подтверждение igg сопряженный второй поражение разница путь граница ros любовь 423 преобразование Эндре 2077 гранулоцит дако вскрытие Chatziioannou пробирка 422 Weiner оценка Работа Тома цопела иммуноанализ сильно 302 САМ перераспределение показатель M2 поведенческий на составной этансульфоновая кислота 593 CR тау Бейройтер химерный старческий Маэда 6000 новый SD проведенный оценка org продвигать C4 пряжка PE Париж ли NM_001195426 taatgaggaagggtcgctgt 1494 три близость GHM соответственно нужный ER покрытие развивать ссылка 2011 г. RM cite Жикай RN Зотова JA Kovaiou состязание прогноз двусторонне PG два заключение сакакибара манент хемотаксический 912 широкий каждый цитируется 923 анатомический 243 RE летчик ваш где роль кофлер1 753 костюм гемосидерин Начните исследуя Переменная RW резка 106 зиолко 2009 г. эксперимент Guidi Версадок задницы незначительный Гилмор SYBR invivogen Морри вхождение отличаться GAPDH ВБ ecx Василевко смешанный в результате многоточечный 1990 г. Wallin MH01717 масса RANTES эффективный ландрет Allison Говард цинация адаптивный идентификация снабжать полный 345 1862 г. половина гомогенизированный ДМСО биологический кланк близко Том Петрушина предел кататься на велосипеде ген Нагаока Браунли хан доступный 238 иммунитет Камимура мехта нарисованный Накамура Fenoglio одобренный эозин ко блокировать DA эволюционно восемь микротовары тем не мение болезнь Альцгеймера Холлидей тестирование сопровождаемый проба вперед приложение с ночевкой приобретенный в сравнении ЖЖ характерная черта шарик кац нейробиология очевидно спинномозговой аденокарцинома двоеточие свободно Лотроп биохимия ценный один тенденция маркировка субстрат Резу Эдвард отношение ресуспендированный делал Гарсия найти краткий RO1 10 DH метод искал wiley1 547 1616 трация любой определять OJF дефектный сайт SM Helmond более год ньяунди руиз бикарбонат сеть мини Aβ1 ослаблять профилактический углерод JAMA лаборатория стандартизированный ДНК среди отчет адаптер 450 считается Ёсикава подробный самый Мерфи анну Вифил анализировать профилирование продемонстрировать столб хемилюмин перед JB было миграция Информация 5343 ЦНС иммунология уменьшился амил сосредоточиться curr щенк хронический WM подмножество январь обращаясь измерение 451 бесклеточный ненормальность опять таки перивентрикулярный периферийно помеченный х200 генотип еще Sadzikava Lim учебный логистический буду фаза много глицин зараженный ни один покрытие объяснил часть сложный BT активно janssen4 в среднем парадигма 982 левый CC 6331 эксперимент видимый карцинома образец препарат, средство, медикамент на очень Только растворимый 236 эндопероксид инфекционное заболевание корреляция сагиттально макака Я БЫ 3232 Лейбман 234 Observa GM корпус NGF NM_001032852 Стрибингер би loosbrock произведено ходок гидроразрыв 1048 разочаровывающий 57co лиса 1000 Бетт лимфоцит преобразование 193 119 tttggctgacctgtttttcc биомедицин тем самым пленник иммунитет развиваться хемоаттрактант нейровоспалительный ПИБ прогностический 8855 nized РБ сильный Arendash пон устойчивый дозирование гамма приближаться Беккард баркай IFN P4 Гамильтон интерферон invitrogen суми в 480 107 передовой хороший дауг преданный журнал зависимый NCBI накопление соотношение 221 ценция мастер переводной остановился экран тогда галаско штат S20 иммуноокрашенный наверное 144 выделил ccgtcaagtgtttcagcaaa формалин алгоритм зарегистрированный удаление воспаление Townsend пирамида из камней Адам задерживается щегольский 177 Иммулон Hillen Веллер связанный непосредственный помфрет Уолтем DF осаждение поведение реактогенность кровь Наварро Розен увеличение виру atcgccgtttccattaaggt да сарита подготовка наименее 1026 утверждал 919 400 bfgf собраны Эйснер 151 повысился шесть ложка фиксированный гидролитический размерный PBS вако независимый подошел FWHM Кроме того 1959 г. полученный обезьяна Сара отражать аналит кислый ЛА следующий хрен TE нитроцеллюлоза передача отклонить постановка гиперплазия ограниченный котилинек врожденный похожий NM_001047118 ОБЪЯВЛЕНИЕ метанол ценить к нерастворимый находка masliah5 оценен биомедицинский держать промытый вращающийся Bielschowsky описанный фрида MCI указывать выдан сульфоксид монокин мул Компания иммунологический SWMR анти Трейси прогрессивный лицензия RT количественно время простагландин объяснение RDS разрешать ited SX Рока час гликозил Talboo 227 кинетический фармакол 255 воспалительный середина почечный крыса сектор лемке 556 Barghorn бык неврология вторичный применяемый некоторые e16032 интрапаренхиматозный функция комитет Карибский бассейн зачисление VD Джану CCL7 неограниченный Ламмерцма джейм CXCL11 иммунодефицит мультиплекс Внедорожник метил замедление Дикарло Clayton 969 Бартон иммуноблот ионизированный улучшение экипаж финансовый 393 выразил выход не Пирсон ультрацентрифуга данный против CD206 воск в возрасте 8532 CCL17 Иссазаде иммуногистохимический кокджон корпус анализ мулатта 303 250 связывать ИССЛЕДОВАТЬ цепь метка 130 очень мбк beta40 сплетение аликвота дифференцированный статья ся начинать удержание сбор диагностика улучшать между удобный WK Космос дополнять IBL фибриллярный симптом тупица сыворотка агрессивно вглядеться Диджей микрокровоизлияние клин Лабковский DP ретроскрипт MA радиоактивность обнаружен эксперт женский наблюдение положительный хотя возчик цзиньбяо община Рускевич подгруппа буфер KR пескинд юнкин действующий лиганд острый Fer Aspinall точный выносливый доза TH извлекать Питтсбург ком Mosser les испытание МИГ моделирование корб CA

исчез 2010 г. переведен Минет 249 Джонетт 4237 икра цент предположительно сдвиг нил публикация Сокращенное название иммунное старение творческий женщины FM www 385 здоровый протеаза лань Windhorst термоловка 985 971 менингоэнцефалити старшая Маслия общественный 479 иммунотерапия шаблон Чаухан выставлен 8354 иммунность Йонссон 598 ОКРУГ КОЛУМБИЯ TA Мюллер определение Оли различные 377 HR лобной ниже с адъювантом 1072 Реншоу Шепардсон PMOD PAI аксональный моль три специфический бард Гриффит нейтрализовать Кастро тело дизайн иголка 2HB Paljug внутренний студия тростник способный мойка пато Winooski дорожка николл с использованием упаковка Морган Один дематто сигнал придаток американец преимущество поскольку XC 3отдел elx800 синаптический критический тромбоцит PDAPP купе контрастный дегидрогеназа 1996 г. Швейцария Hickman 484 1078 заразить Икономович 1036 ing паренхиматозный произошел вовлеченный подпись сканировать фагоцитоз исправленный Другие Когда-либо 239 преходящий пептид срок пушка как обычно стандартизация метаб Луи Университет появился противник временный SG ВЕЧЕРА abeta40 невропатология иммуноглобулин Google литература центрифу олигомерный Другая Национальные институты здравоохранения США цель Посмотреть aacctcctcctcgtggatct цзин 2008 г. вошел иммунизированный недоступен корп нормализованный оформление инициация некротизирующий среда сканирование ограничено неспособный рукопись специфичность Steponeplu подростковый предполагаемый последствия каджизоно Анна завершенный против бицинхониновый нервный периферийный Клюбин окончательный в MJ прусский нарушить Национальные институты здравоохранения США CW06 хотел боумен строительные леса Кристи Катто визуализация исключительно прока Ханссон цзе Ровира изгиб коммерческий 3000 генетический повышенная 2004 г. GE обесценение изменение aacagatggccttgttctgg пятно генерировать 5042 отклик K24 561 RO секс хорошо 357 недавний потому что состояние потенциал онкоцитома 297 хори TAC PTGS сотовый Нью-Джерси десятилетие уровень СПИД плотность никто тетрауксусный мер CCL2 tgatgagaggcagcaagatg спектрометрический последовал CJ регулируемый 958 меньше 3299 фи Валенсия связаны оптический гидролаза VT 173 Schoonenboom тигге 3067 Лифсон Гевиртц сделано отображение неврологический Fremont Эршлер указание иммунизация предыдущий 283 мар 4728 вращаться эффро управление нормализация коктейль cie ориентация сложный когорта снижаться стерильный маркер немного рано подкожно равный AN1792 Анвил II кда Мерфи вихрь 118 форма JN 358 L1 CAW синтезированный давать диамен астроцит xmap оптимальный Депутат 220 Шанкар кер использовал Welzel фигура циномолгу BSA смешать Glabe моноцит ни полимераза сегментация Коллер микроглия 572 когда ответственный MG SR фон косяк полученный ангиопатия размещенный рябина тормозящий pubmed Феррер модер заболеваемость тянь димерный Декоски возможно вызов http амбион симултан 1999 г. пуэль плю Луард мая повторно акад солюбилизированный исследовать NM_001077483 другой монофосфорил функциональный я алмаз EB Wilkinson иначе реконструирован малолетний Геркулес Лента новостей немедленный середина диалиси раскрывать HL cdna ключевой Роман фосфо 1845 г. Blankenstein шах AS04 спе камарильо Иллинойс RC чт Фаррелл TG невропатологический Режим 80oc 1645 вирол осмотр дальше колония ферроцианид 5031 изменение диоксигеназа Уолш маргинальный цзян эмфизема PK11195 10369 TGF ширина стучать боевой количество 452 эндотелиальный 579 EDTA 4701 риллар Pensalfini влиять называется Сравнительная степень институт Чжэн актуальность подведены додекамер уменьшать 237 численность населения тестовое задание выгодный графическая панель 567 шаг проекция 100 столбец Хендерсон как МБ идентичный 800 интрацеребровентрикулярный сканер VEGF Паттон додар меринос их шкала мем соколова администрация следовательно носовой Schapiro неизвестный многообещающий включены интерпретация 235 ЦПО эмиссия скорректированный буф вопрос 296 точка IU рука SK DW подтверждающий Aβ40 представление дисфункция унесенный поведение insti якуб трансаксиальный печень требуется нейроиммунный поток морфолино Мартинес кора также 2012 г. корковый был он LC Хуан ткань 000 распределение связанные с ассо рак обезьяна мембрана тоже биол выступал за небольшой терапевтический над ванда во многом позвоночник нашел кратко кофлер сборка цвет XM_001110126 ince соглашение ассоциация побудить шахтер не допустить соответствие TM 1500 позитрон гениальность игра Finn3 накл когни Doef PA15213 статистический совместно управляемый нравиться 8538 Паллиду NE калий повторяется 10379 Цзяньпин вырождение Скарпини IP нейрофиб Burke CXCL9 нейродегенератор включают ха потери вряд ли Кармона 352 низкий свидетельство YKL40 активирован аутоиммунный 369 через в то время как тетра успех модификация сильнее возбудитель колебание Павел повышаться Чисто ген брать Craig мономер 500 нечеловеческий на основании загрузка Макленнан конфликт дополнение CE MCP развитый минимизировать минута NM_001032936 L9 Schelten Wilcock CSF коклюш XL specu французкий язык передача внутригиппокампальный упрощенный тример tggaaggactcatgaccaca поддерживается Бабикян судно CL гистопатологический термонаучный страница Microhe пространственный читать нейрон мобилизация депозит поле iba убит выбор Сэм центрифугирование завершение больше такой щелчок парафин 150 Ван степень окно незатронутый DR дифтерия FL Гольцман Текущий край димер транслокатор накопление успешный настоящее время иммуно GFAP минимальный Mattsson боди агуцци Мейерманн успешно вмешательство TLR4 1547 Гомес патол оценен Холм член MT ферментированный hcl прерванный JR микроглиаль архивный возвышенный 492 время TN оценивать мент адъювант Knoxville эозинофильный SWM Макартур 5отдел трудность или общий несогласие обнаруживать 429 здоровье 1328 Грин через хемокин человек рассмотрение классический Лазо дважды 4697 1392 шпаргалка Гвидо оцененный мас астроцитарный трансгенный 1603 хислоп серия Темекулярный хенке индоламин загар Общее научный максимум Пэн lopresti2 кофлерк примат МРТ Modifica клетка 159 пять покрытый очевидный mfcx Auwera показал Streffer 538 KH Лоран представлять барбур реакция чакрабарти 9500 2007 г. уверен доминирующий 162 Агаджанян взрослый список из неопубликованный прото МО вервета Ян причина Gannon данн делонг Thal усыплен рецептор после этого 201 Маккель макрос CCR5 ST сцена невропатол высота Томпсон KS раздел размер 1742 г. молния ГВт злокачественное новообразование инвестировать закрытый пластичность таламу cccttgggtgtgaaaggtaa вареный хвостатый Seubert боковая сторона муравьиной здравоохранение иммунопозитивный 1341 улица JD Koenigsknecht фибриллярный альбумин ответчик агрегированный Влачули МИФ изменить биофия снижение Вентурелли цвести остаток средств нейровоспаление даровать Депозиты левит ПЦР 2094 последствие группа безопасность кислота короткая идентификация S2 использовать консорциум заметно пхам неделя несмотря аденоматоу AMT 11C ассоциированный вакцинация до NM_001032892 169 478 398 PS1 телесно кехо Джонсон умеренно старение хью температура минтун Макгоуэн мозолистое тело Такашима РФ олиго трубка Дави 343 терапия 8249 Rojiani позиция PT против NB 3310 наложенный существующий NHP Майкл исправление плата 321 протокол NI CB акт редкий средство JK типичный предшественник хитрый мышь золото вклад циркадный безопасно голова инактивированный Dietz ниммрих Маклаурин соответственно антиген 172 CCL3 учреждать RL лед Кальбак CA1 педиатр 223 сицилия наблюдаемый анатоксин принято к сведению 420 Crain рост интересно самый высокий иметь в виду Саннивейл AR Диего Каварабаяши невосприимчивый Гордон патологический Комплект ивашиге Дубой съеденный около воспроизведение обязанность одновременный не мочь привязка нет отметка взаимный SS спектр головной мозг 277 оргогоозо строгий активация edu синаптотоксичность тори когнитивно Зеттерберг tgatggccttagattctgga начало оставаться старение Анита разделение интерлейкин рядом, поблизости диапазон Reso усвоение Средняя 133 CAS Дэниел CW07 пидор гемофилия тяжелая форма эффект ядро коробка передач бета contrera Giudice уменьшенный RSB тюк остался XM_001107538 Ли стандарт монета энцефалит Накаяма 3-й перспектива ПРИЛОЖЕНИЕ Шмидт 8360 до энторинал Лемер Аннотация Schwanninger крупный Натл люция начальный Oid XM_001102095 разлагаться инструкция комната абета отсутствующий пополам высокий не согласен выше продемонстрировал помощь Соединенные Штаты Америки комбинированный первый иммунол лептоменингеальный гбк кимура оливера играть общий анализировать 37oc Дедхэм обратимый кандидат подъячейка противоречивый 2003

РАСПРОСТРАНЕНИЕ И РАЗМЕР ООИДОВ ПОСЛЕ ПЕРМИАН-ТРИАССИЧЕСКОГО МАССОВОГО ИСКЛЮЧЕНИЯ на JSTOR

Абстрактный

Значительное увеличение численности и расширение среды осадконакопления, которая образовала необычные отложения в раннем триасе, указывает на стрессовые состояния экосистем после пермско-триасового (P-Tr) массового вымирания.Являясь одним из типично распространенных карбонатных отложений раннего триаса, ооиды представляют собой потенциальный прокси для уточнения понимания биотических и экологических стрессов в это время посредством анализа их формирования и изменений размеров. В данном документе представлены тематическое исследование из Южного Китая и глобальный обзор для изучения взаимосвязи между появлением оолитов и вариациями размера ооидов с биотическими и экологическими изменениями. Корреляции между оолитами и различными биотическими и экологическими изменениями предполагают сильное соответствие с эпизодами эвксинии / дизоксии, но в меньшей степени с обилием скелета и изменениями температуры, подразумевая сложные взаимодействия между множественными биотическими и экологическими аномалиями после вымирания P-Tr.Эпизодическая картина появления оолитов с конца перми до раннего триаса совпадает с многочисленными кризисами массового вымирания P-Tr и его последствиями. Глобальное увеличение размеров ооидов на ранней стадии последствий массового вымирания P-Tr указывает на самые тяжелые и обширные условия опустошения экосистем. Единичное появление гигантских ооидов в бассейне Наньпаньцзян в пределах оленекского яруса предполагает более высокий уровень стресса для экосистемы, чем в других районах. Этот анализ изменений размера ооидов и палеоокеанографические последствия позволяют предположить, что размер ооидов может быть подходящим количественным показателем осадочных отложений для опустошения экосистемы с различными временными и пространственными диапазонами.

Информация о журнале Содержание

PALAIOS подчеркивает влияние жизни на историю Земли. Основанный в 1986 году, это журнал, выходящий раз в два месяца, который распространяет информацию среди геологов и биологов со всего мира, интересующихся широким кругом тем, включая, помимо прочего, биогеохимию, ихнологию, палеоклиматологию, палеоэкологию, палеоокеанографию, седиментологию, стратиграфию, геомикробиологию. , палеобиогеохимия и астробиология.PALAIOS публикует оригинальные статьи, в которых особое внимание уделяется использованию палеонтологии для ответа на важные геологические и биологические вопросы, которые способствуют нашему пониманию истории Земли. Соответственно, для публикации с гораздо большей вероятностью будут отобраны рукописи, предмет и выводы которых имеют более широкое геологическое значение, а не узконаправленные дискурсы. PALAIOS — это предпочтительный журнал для публикации новаторских исследований, охватывающих все аспекты прошлой и настоящей жизни, на основе которых можно расшифровать геологические, биологические, химические и атмосферные процессы и применить их для поиска решений прошлых и будущих геологических и палеонтологических проблем.

Информация об издателе

SEPM (Общество осадочной геологии) — международное некоммерческое общество со штаб-квартирой в Талсе, Оклахома. Через свою сеть международных членов Общество занимается распространением научной информации по седиментологии, стратиграфии, палеонтологии, наукам об окружающей среде, морской геологии, гидрогеологии и многим другим смежным специальностям. Общество поддерживает своих членов в их профессиональных целях, публикуя два крупных научных журнала: Journal of Sedimentary Research и PALAIOS.Кроме того, SEPM выпускает конференции по техническим исследованиям, короткие курсы и специальные публикации. Посредством программ непрерывного образования, публикаций, встреч и других программ SEPM участники получают и обмениваются информацией, относящейся к их геологическим специальностям.

Синтез, катаболизм и передача сигналов гиалуронана при нейродегенеративных заболеваниях

Гликозаминогликан гиалуронан (НА), компонент внеклеточного матрикса, участвует в регуляции дифференцировки, выживания, пролиферации, миграции и передачи сигналов клеток в центральной нервной системе млекопитающих. (ЦНС).HA обнаруживается по всей ЦНС как составная часть протеогликанов, особенно в перинейрональных сетях, которые участвуют в регуляции активности нейронов. ГК также обнаруживается в белом веществе, где он диффузно распределяется вокруг астроцитов и олигодендроцитов. Повреждения ЦНС приводят к долгосрочному повышению уровня HA в поврежденных тканях, что, по крайней мере частично, связано с повышенной транскрипцией HA-синтаз. Накопление HA часто сопровождается повышенной экспрессией по крайней мере некоторых трансмембранных рецепторов HA, включая CD44.Гиалуронидазы, которые переваривают высокомолекулярную HA на более мелкие фрагменты, также повышаются после поражения ЦНС и могут генерировать продукты переваривания HA, которые обладают уникальной биологической активностью. Ряд исследований, например, предполагают, что как удаление высокомолекулярной НА, так и накопление продуктов переваривания гиалуронидазы, производимых гиалуронидазой, могут влиять на повреждения ЦНС через механизмы, которые включают регуляцию дифференцировки и пролиферации клеток-предшественников. Эти исследования, рассмотренные здесь, предполагают, что нацеливание на синтез, катаболизм и передачу сигналов HA — все это потенциальные стратегии, способствующие восстановлению ЦНС.

1. Введение

До 20% объема центральной нервной системы (ЦНС) млекопитающих состоит из внеклеточного матрикса (ЕСМ), который включает белки, протеогликаны и гликозаминогликаны [1]. Растущие данные указывают на то, что состав и организация этой матрицы изменяются в ходе нормального старения, при нейродегенеративных заболеваниях и после повреждения ЦНС, и что эти изменения влияют на широкий спектр клеточного поведения. Первоначально считалось, что ECM ЦНС играет в основном структурные роли, включая поддержку архитектуры тканей.Однако открытия последних нескольких десятилетий показывают, что ECM ЦНС представляет собой богатую информацией среду, которая включает сигналы, которые влияют на пролиферацию, дифференцировку, миграцию, образование и ремоделирование синапсов, а также ответы на повреждения [2-7].

Состав и функции ECM ЦНС могут различаться в разных областях ЦНС [8]. Например, ЕСМ белого вещества гораздо более рассеян по сравнению с ЕСМ серого вещества. Внутри серого вещества перинейрональные сети, которые окружают тела и дендриты некоторых нейронных клеток, состоят из плотной матрицы гликозаминогликанов, протеогликанов, тенасцина R и связывающих белков.Этот специализированный ECM может регулировать синаптическую пластичность [9], в то время как отрицательно заряженные гликозаминогликаны могут влиять на диффузию катионов, которые поддерживают быстрое возбуждение нейронов [10]. Другая отличная среда ECM может быть обнаружена в базальной пластинке, окружающей сосуды головного мозга, которая состоит из коллагена, фибронектина, перлекана, дистрогликана и комплексов ламинин-нидоген. Он окружает пиальную поверхность ЦНС и отделяет эндотелиальные клетки от паренхимы, тем самым создавая гематоэнцефалический барьер [8].

Хотя многочисленные исследования выявили участие протеогликанов в ответе на повреждение ЦНС и в опосредовании воспалительных реакций и выздоровления (прекрасные недавние обзоры см. [11–13]), появляется все больше доказательств того, что гликозаминогликан гиалуронан (HA) играет особую роль в регуляции нервной системы. пролиферация и дифференцировка клеток-предшественников. ГК представляет собой большой неразветвленный несульфатированный гликозаминогликан, состоящий из повторяющихся дисахаридных единиц N-глюкуроновой кислоты и N-ацетилглюкозамина, и является основным компонентом ЕСМ.ГК может достигать 25000 единиц дисахарида с молекулярной массой до 10 7 Да. ГК может выполнять различные физиологические функции в зависимости от его размера, концентрации и локализации. Эти функции включают изменение гидратации и эластичности тканей и создание бесклеточных пространств, которые имеют решающее значение для миграции клеток. Кроме того, HA может индуцировать передачу клеточных сигналов через трансмембранные рецепторы HA.

HA синтезируется на внутренней стороне плазматической мембраны и секретируется во внеклеточное пространство в виде линейной недекорированной молекулы.У млекопитающих синтез HA достигается семейством трансмембранных белков, известных как HA-синтазы (HAS). Геном млекопитающих кодирует три таких синтазы: HAS1, HAS2 и HAS3. Катаболизм HA осуществляется гиалуронидазами (HYAL), которые различаются по своей клеточной локализации и оптимуму pH. Млекопитающие обладают множеством генов гиалуронидазы, включая HYAL-1 — HYAL-5, Ph30 / SPAM1, а у людей — псевдогеном, обозначенным PHYAL-1. Давно признано, что баланс между синтезом и катаболизмом ГК играет роль в развитии ЦНС (например,г., [14–17]). Здесь мы рассматриваем данные, касающиеся изменений в синтезе, передаче сигналов и катаболизме HA в ответах популяций клеток-предшественников на нейродегенеративные заболевания и повреждения ЦНС, и обеспечиваем основу для оценки эффективности нацеливания на HA как стратегии, способствующей восстановлению ЦНС.

2. ГК накапливается в поврежденной ЦНС
2.1. Ишемическая травма

В неповрежденной ЦНС ГК диффузно распределена по белому веществу, но плотно упакована в серое вещество, включая перинейрональные сети (рис. 1).Повреждение ЦНС приводит к накоплению ГК [4, 18] как в белом, так и в сером веществе, которое может сохраняться в течение длительных периодов времени после первоначального повреждения. В большинстве случаев патологическое повышение HA связано с повышенной транскрипцией HAS и часто связано с реактивным астроглиозом и рубцеванием глии. Этот эффект наиболее подробно изучен в контексте ишемических повреждений. Например, мРНК HAS2 обычно экспрессируется на очень низких уровнях в ЦНС, но значительно увеличивается в течение 6 часов после окклюзии средней мозговой артерии у крыс [19].HA также был повышен до шести недель после фототромботического инсульта в коре головного мозга взрослых мышей [20]. В соответствии с этими экспериментальными данными, HAS1 и HAS2 повышены в инфарктных и периинфарктных тканях пациентов, перенесших ишемический инсульт [21]. Уровни ГК в плазме крови также были значительно повышены у пациентов с острым инсультом по сравнению с контрольной группой и могли предсказать функциональные результаты через 3 месяца, особенно у пациентов с внутримозговым кровоизлиянием [22].


В дополнение к результатам, полученным у взрослых пациентов и на взрослых моделях инсульта, HA также заметно повышается при перинатальных гипоксически-ишемических повреждениях белого вещества головного мозга.Поражения, вызванные этими оскорблениями, являются основной причиной церебрального паралича у лиц, переживших преждевременные роды, и способствуют сохранению невроповеденческих нарушений на всю жизнь. HA накапливается в ECM при недоношенных хронических поражениях белого вещества головного мозга у людей, совпадающих с обширным реактивным астроглиозом [23]. Точно так же в модели церебрального гипоксически-ишемического повреждения у плодов овцы ГК быстро увеличивалась через 24 часа после единичного эпизода гипоксии-ишемии плода и оставалась устойчиво повышенной в течение недель [24].

2.2. Судороги

Судороги также изменяют синтез ГК в ЦНС, но не совсем ясно, увеличивает или уменьшает судорожная активность. Эпилептические припадки могут влиять как на поведение существующих нейронов, так и на нейрогенез взрослых (генерация новых нейронов). Одним из следствий этих изменений является ненормальное прорастание аксонов гранулярных клеток (так называемое прорастание мшистых волокон) в зубчатой ​​извилине гиппокампа, области мозга, участвующей в обучении и памяти.Деградация HA в органотипических культурах срезов гиппокампа с гиалуронидазой значительно снижает индуцированное каиновой кислотой разрастание мшистых волокон, синаптическую перестройку, связанную с височной эпилепсией [25]. Интересно, что и HA, и HAS3 уменьшают периневрональные сети в гиппокампе после приступов в модели височной эпилепсии на грызунах [26], в то время как Has3 -нулевые мыши имеют уменьшенные объемы гиппокампа и развивают эпилептические припадки [17]. Эти данные предполагают, что снижение уровня ГК может способствовать возникновению и повторению приступов, но переваривание ГК гиалуронидазой может генерировать продукты ГК, которые уменьшают прорастание мшистых волокон и, возможно, цепи положительной обратной связи для генерации приступов.В отличие от исследований на грызунах, у пациентов с трудноизлечимой мезиальной височной эпилепсией наблюдалось увеличение ГК в гиппокампе и височной неокортексе [27]. Возможно, что это несоответствие с исследованиями на грызунах связано с тем фактом, что в образцах тканей человека было больше хронических повреждений с обширным астроглиозом по сравнению с тканями грызунов, и что восстановление ГК совпало с глиальным рубцеванием.

2.3. Травматические повреждения головного и спинного мозга

В течение 5 месяцев после дорсальной ризотомии проксимальнее ганглиев задних корешков Mansour с соавторами [28] обнаружили повышенную иммунореактивность глиального гиалуронан-связывающего белка (что обычно отражает повышение HA).В другом исследовании ушиб спинного мозга у крыс приводил к деградации ГК в месте повреждения с последующим повышенным накоплением в течение одного месяца после травмы [29]. HA был самым высоким в регионах, где был обширный астроглиоз. Исследование контролируемого ударного повреждения коры у крыс (в качестве модели черепно-мозговой травмы) показало, что мРНК HAS1 и HAS2 увеличиваются в любом месте от 4 часов до 3 дней после травмы по сравнению с одной только трепанацией черепа [30]. Однако это исследование не подтвердило их выводы путем изучения распределения или уровней HA.Тем не менее, эти данные указывают на то, что травматические повреждения ЦНС приводят к долгосрочному увеличению ГК в пораженных тканях.

2.4. Демиелинизирующие заболевания

Ряд исследований продемонстрировали повышенное содержание ГК в поражениях ЦНС, связанных с нейродегенеративными заболеваниями, влияющими на белое вещество. Например, HA повышается в демиелинизирующих поражениях белого вещества у мышей с экспериментальным аутоиммунным энцефаломиелитом и у пациентов с рассеянным склерозом, оба из которых являются аутоиммунными заболеваниями, при которых миелин-реактивные иммунные клетки вызывают демиелинизацию [31–33].HA также повышен в мозге пациентов с болезнью исчезающего белого вещества, генетической лейкоэнцефалопатией, вызванной мутациями в факторе инициации трансляции эукариот 2B [34]. У этих пациентов наблюдается медленно прогрессирующее неврологическое ухудшение с эпизодами быстрого клинического ухудшения, вызванного стрессом. Накопление ГК было особенно выражено в пораженном лобном белом веществе, но не в незатронутом белом веществе мозжечка у этих пациентов.

2,5. Нормативное старение и деменция

Накопление ГК в ЦНС также происходит в ходе нормального старения.Умеренное увеличение HA наблюдалось в ткани мозга 30-месячных крыс по сравнению с тканями более молодых животных [35]. Уровни HA также значительно увеличиваются с возрастом в сером веществе макак-резусов и японских макак в областях с астроглиозом и совпадают с повышенной транскрипцией HAS1 , экспрессируемой реактивными астроцитами [36]. ГК аналогичным образом повышен в сером веществе у пациентов с болезнью Альцгеймера (БА) [37, 38] и в белом веществе пациентов с сосудистой деменцией, которые имеют низкое бремя патологии БА, сопровождающейся сосудистым повреждением, соответствующим сосудистой деменции [39].В соответствии с этими результатами, Nägga и соавторы [40] наблюдали значительно повышенные уровни HA в спинномозговой жидкости (CSF) у пациентов с сосудистой деменцией, но не только с AD, по сравнению с контрольной группой. Это согласуется с выводами Laurent и соавторов [18], которые наблюдали повышенный уровень ГК в спинномозговой жидкости (CSF) у пациентов с рядом различных неврологических заболеваний. Повышенные уровни HA также наблюдались в спинномозговой жидкости у лиц с сосудистыми аномалиями, определяемыми как значительные изменения белого вещества, или у пациентов с перенесенным инфарктом по сравнению с людьми, у которых таких результатов не было [40].Была обнаружена положительная корреляция между уровнями HA и соотношением CSF / сывороточного альбумина, показателем целостности гематоэнцефалического барьера, у пациентов как с сосудистой деменцией, так и с AD. Эти данные подтверждают мнение о том, что ГК накапливается в сером веществе в ходе нормального старения и в дальнейшем увеличивается в белом веществе в случаях возрастного повреждения сосудов.

В совокупности описанные выше данные демонстрируют, что HA накапливается, вероятно, из-за повышенной транскрипции HAS при самых разнообразных повреждениях ЦНС.Накопление HA обычно связано с астроглиозом, и действительно, реактивные астроциты демонстрируют повышенный HAS. Вероятно, это объясняет хронически высокий уровень ГК в глиальных рубцах. Как показали исследования на моделях травмы и судорог спинного мозга, ГК может изначально разлагаться из-за возможной индукции специфических гиалуронидаз или других факторов в ранней среде травмы, но, по крайней мере, при хронических поражениях, быстро накапливается до более высоких, чем нормальных уровней, сохраняются в течение длительного времени после первого оскорбления.По крайней мере, при некоторых оскорблениях этот повышенный HA может быть обнаружен в спинномозговой жидкости. Будущие исследования, сфокусированные на изучении того, когда концентрации HA становятся заметно повышенными в спинномозговой жидкости после различных повреждений ЦНС, продемонстрируют потенциал HA в качестве диагностического биомаркера повреждения ЦНС.

3. Накопление HA изменяет пролиферацию и дифференцировку нервных клеток-предшественников
3.1. Влияние HA на нейральные клетки-предшественники и глию

Каковы последствия длительного накопления HA в поражениях ЦНС? Помимо своей роли в развитии нервной системы и гомеостазе, HA может влиять на восстановление нервной системы, изменяя пролиферацию, миграцию и дифференцировку популяций клеток-предшественников в ЦНС.При демиелинизирующих поражениях, в том числе у пациентов с рассеянным склерозом, некоторое восстановление функции связано с рекрутированием клеток-предшественников олигодендроцитов (OPCs), которые дифференцируются в олигодендроциты (OLs), которые ремиелинизируют сохраненные аксоны [41]. Однако при хронических поражениях белого вещества OPCs накапливаются и не могут вызывать миелинизирующие OL [42–47]. Присутствие HA в демиелинизирующих поражениях коррелирует с областями, где ремиелинизация не удается, и добавлением высокомолекулярных препаратов HA (> 10 6 Да) к OPCs грызунов in vitro , культурам срезов белого вещества или к лизолецитину. индуцированные демиелинизирующие поражения мозолистого тела блокируют дифференцировку и ремиелинизацию OPC [31, 32, 48].Интересно, что HA с высоким молекулярным весом также блокирует пролиферацию астроцитов [29] и подавляет рубцевание глии [49]. Таким образом, хотя накопление HA в демиелинизирующих поражениях связано с ингибированием созревания OPC и неудачей ремиелинизации, оно также может опосредовать образование глиальных рубцов.

HA может также играть роль в привлечении OPC к демиелинизирующим поражениям. После демиелинизирующих поражений OPC мигрируют к поврежденным аксонам, прежде чем дифференцироваться в миелинизирующие OL. Используя линию OPC, Пиао и соавторы [50] обнаружили, что снижение экспрессии рецептора HA CD44 или обработка клеток антителом, блокирующим CD44, ингибируют миграцию OPC как in vitro, , так и после трансплантации в воспалительные демиелинизирующие поражения.Хотя авт. Сообщили о повышении HA в этих поражениях, еще предстоит определить, требуется ли HA непосредственно для миграционного поведения этих клеток. Тем не менее, эти данные предполагают, что, хотя HA может блокировать созревание OPC, когда обнаруживается в избытке в демиелинизирующих поражениях, HA также может потребоваться для облегчения рекрутирования OPC в поражения CD44-зависимым образом.

3.2. Роль HA в нишах нервных стволов и клеток-предшественников

В то время как HA в основном наблюдается на низких уровнях в неповрежденном мозге взрослого человека, он остается на высоких уровнях в субвентрикулярной зоне взрослого человека, субгранулярной зоне зубчатой ​​извилины гиппокампа и ростральный миграционный поток, области, где нервные стволовые клетки / клетки-предшественники (NSPCs) находятся на протяжении всей жизни [20, 51].HA, следовательно, может играть роль в регуляции NSPCs в их нишах [52]. Хотя неясно, какую прямую роль HA играет в нишах NSPC, в ряде исследований изучалось влияние гелей HA на NSPC и использование этих гелей в качестве носителей в исследованиях трансплантации NSPC [52]. Например, гидрогели HA значительно улучшили выживаемость линии NSPC человека и глиальных клеток-предшественников после трансплантации в мозг мышей [53]. В другом исследовании биополимерный гидрогель, состоящий из поперечно сшитой НА и сульфата гепарина, значительно способствовал выживанию линий NSPC in vitro, в условиях стресса и in vivo, , после трансплантации в полость инфаркта на модели инсульта [54].Деградация гелей НА, инкапсулирующих нейральные клетки-предшественники, вызвала дифференцировку и созревание клеток-предшественников.

В совокупности эти исследования подтверждают, что HA в нишах NSPC играет критическую роль в регуляции пролиферации и дифференцировки NSPC. Эта функция HA повторяется в демиелинизирующих и, возможно, других поражениях, где OPCs сталкиваются с подобной нише средой, богатой HA, которая может влиять на миграцию OPC, пролиферацию астроцитов и дифференцировку глиальных клеток.Предположительно, уровни и распределение HA в нишах NSPC д. Строго контролироваться, чтобы регулировать дифференцировку NSPC. Задача будет заключаться в идентификации средств контроля синтеза или катаболизма HA в нишах NSPC или областях поврежденных тканей ЦНС таким образом, чтобы способствовать восстановлению нервной системы. Использование биоматериалов HA, как описано выше, может регулировать функции HA как в нишах стволовых клеток, так и в поражениях ЦНС, предлагая потенциальный подход к терапии на основе стволовых клеток / клеток-предшественников (обзор в [52]).

4. Эндогенные гиалуронидазы влияют на восстановление ЦНС

Как обсуждалось выше, существует несколько гиалуронидаз млекопитающих, которые катаболизируют ГК в тканях. Хотя переваривание высокомолекулярной HA может иметь свои собственные биологические последствия, накопление продуктов переваривания HA, генерируемых гиалуронидазами, также может иметь различные, зависящие от размера активности.

4.1. Роль гиалуронидаз в повреждении и заболевании ЦНС

Первым признаком того, что гиалуронидазы играют роль в ЦНС, стало наблюдение, что в развивающемся головном и спинном мозге наблюдается высокий уровень активности гиалуронидазы, которая снижается в раннем перинатальном периоде [14 ].Активность и экспрессия гиалуроиндазы в ЦНС взрослого человека обычно низкие. Однако после ряда поражений нервной системы экспрессия и активность гиалуронидазы увеличиваются. Например, как в области инсульта, так и в периинфарктной области у пациентов с ишемическим инсультом, HYAL1 и HYAL2 были повышены в воспалительных клетках, микрососудах и нейронах [21]. Повышенная экспрессия гиалуронидазы сопровождалась накоплением низкомолекулярной (3–10 дисахаридов) HA, предполагая, что повышенная экспрессия гиалуронидазы в ишемических поражениях ЦНС сопровождается накоплением продуктов переваривания HA.

мРНК Hyal1 также была повышена у крыс после трепанации черепа или контролируемого коркового ударного повреждения [30]. Другие гиалуронидазы, включая Ph30 / SPAM1, также были обнаружены и показали тенденции к повышенной экспрессии, но изменения не были значительными. Точно так же гиалуронидазы были повышены в демиелинизирующих поражениях, где накапливается ГК. Sloane с соавторами [32] с помощью иммуноцитохимии обнаружили, что OPC экспрессируют несколько гиалуронидаз, включая Ph30 / SPAM1 (далее называемый Ph30). Этот результат был неожиданным, поскольку предыдущие исследования не обнаружили Ph30 в мозге.Последующее исследование продемонстрировало, что Ph30 экспрессируется астроцитами и OPC мыши как in vitro, , так и в демиелинизирующих поражениях мышей и человека с помощью иммуногистохимии и, у мышей, с помощью ОТ-ПЦР [55]. Этот амплифицированный продукт ОТ-ПЦР имел тот же размер, что и Ph30, амплифицированный из семенников мыши, не происходил из геномной ДНК и был подтвержден секвенированием как Ph30. Более того, инфицирование OPC лентивирусом, несущим кДНК Ph30, но не других гиалуронидаз, обычно экспрессируемых OPCs, блокирует дифференцировку OPC [55].Обработка OPCs in vitro ингибитором гиалуронидазы широкого спектра действия (аскорбат 6-гексадеканоат) способствовала созреванию OPC [32, 55], в то время как лечение демиелинизирующих поражений ингибитором преодолело ингибирующие эффекты высокомолекулярной HA на ремиелинизацию, что привело к функциональное восстановление [55].

Еще одно доказательство того, что Ph30 повышается в ЦНС после травмы, получено на модели пренатального повреждения белого вещества у овец, описанной выше, где повышенная экспрессия Ph30 у овец была подтверждена с помощью нескольких подходов [24].Один транскрипт Ph30 был обнаружен с помощью вложенного анализа RT-PCR мРНК, выделенных из контрольного и поврежденного белого вещества в двух отдельных лабораториях. Этот транскрипт имел тот же размер, что и в семенниках плодов овцы, был получен с использованием нескольких наборов праймеров, не происходил из геномной ДНК и был подтвержден секвенированием как Ph30. Ph30 также был обнаружен в белом веществе плода овцы с помощью RNA-Seq в данных, полученных от 10 животных, при этом подтверждено, что последовательность Ph30 плода овцы является высокогомологичной Ph30 грызунов и человека.Наконец, Ph30 был обнаружен иммуногистохимическим методом в тканях мозга эмбриона овцы с использованием двух отдельных поликлональных антисывороток кролика и курицы. Более низкие уровни окрашивания Ph30 в контроле по сравнению с группами с повреждениями белого вещества подтверждают мнение о том, что экспрессия Ph30 повышается после пренатального гипоксически-ишемического повреждения. Все вместе эти данные подтверждают гипотезу о том, что Ph30 и, возможно, другие гиалуронидазы блокируют созревание и ремиелинизацию OPC.

4.2. Гиалуронидазы могут влиять на активность нейронов

Неясно, влияют ли эндогенные гиалуронидазы на функцию нейронов.Однако ряд исследований показал, что ГК в перинейрональных сетях может влиять на активность нейронов, которая может быть изменена лечением гиалуронидазой. Например, удаление перинейрональных сетей с использованием гиалуронидазы в срезах гиппокампа молодых крыс уменьшало ширину синаптической щели и увеличивало амплитуду возбуждающих постсинаптических потенциалов в аксодендритных связях CA1 [56]. Из этого и других исследований разумно заключить, что богатые HA перинейрональные сети могут влиять как на эффективность, так и на архитектуру синапсов.Более того, контролируемая деградация HA в перинейрональных сетях может быть механизмом, используемым для изменения синаптической пластичности, лежащей в основе обучения и памяти. Сообщалось также, что гиалуронидаза регулирует перемещение рецептора α -амино-3-гидрокси-5-метил-4-изоксазолепропионовой кислоты (AMPA) в синапс и из синапса [57], предполагая, что HA может контролировать пластичность отдельных синапсов посредством создание отдельных мембранных компартментов и контроль пассивной диффузии молекул на поверхности клетки.Интересно, что перисинаптический HA может влиять на латеральную подвижность на плазматической мембране по-разному на шипованных и аспиновых нейронах [58]. Как регулируется этот перинейрональный HA, неясно. Однако интересно предположить, что гиалуронидазы, экспрессируемые нейронами или локальными глиальными клетками, могут регулировать активность нейронов посредством регулируемого катаболизма HA.

4.3. Продукты переваривания HA, генерируемые гиалуронидазами, могут влиять на поведение нервных клеток-предшественников

Хотя переваривание HA гиалуронидазами может ослаблять передачу сигналов, индуцированных высокомолекулярным HA, продукты переваривания HA, генерируемые гиалуронидазами, также могут иметь свои собственные отличные биологические активности в ЦНС.Например, продукты переваривания HA, генерируемые гиалуронидазой яичка крупного рогатого скота (активность которой в основном Ph30), но не продукты другой гиалуронидазы, напрямую блокируют дифференцировку и ремиелинизацию OPC [55]. Это открытие интересно в свете наблюдения, что продукты переваривания HA размеров, которые согласуются с теми, которые, как предполагается, образуются за счет активности гиалуронидазы, накапливаются в очагах демиелинизированного рассеянного склероза [32]. Остается определить, влияют ли продукты переваривания Ph30 напрямую на созревание OPC при ишемических повреждениях ЦНС так же, как они влияют на демиелинизирующие поражения у взрослых.

Дополнительные доказательства, подтверждающие возможность того, что продукты HA, генерируемые гиалуронидазой, могут влиять на восстановление нервной системы, получены из исследований с использованием олигосахаридов HA. Например, тетрасахарид НА улучшает функциональное восстановление после повреждения спинного мозга, возможно, за счет индукции экспрессии нейротрофического фактора головного мозга (BDNF) и фактора роста эндотелия сосудов (VEGF) в астроцитах в окружающей среде повреждения [59]. Тетрасахариды НА могут также способствовать разрастанию аксонов и регенерации периферических нервов [60].Неясно, блокируют ли эти тетрасахариды взаимодействия между ГК других размеров и их рецепторами, или они имитируют эффекты продуктов переваривания ГК.

Эти исследования показывают, что каждая из высокомолекулярных и переваренных форм ГК выполняет различные функции после повреждения нервной системы и во время выздоровления. Продукты HA определенных размеров, которые накапливаются в поврежденной ЦНС, могут индуцировать клеточные сигналы, которые предотвращают дифференцировку и ингибируют восстановление, в то время как другие могут индуцировать отдельные сигналы, которые поддерживают эту активность.Определение того, как эти продукты образуются, точных размеров фрагментов HA, которые влияют на передачу сигналов в клетках в популяциях нервных предшественников, а также рецепторов и нижестоящих эффекторов, которые регулируют эти сигналы, вероятно, приведет к новым стратегиям, способствующим восстановлению нервной системы.

5. Уровень рецепторов НА повышается в поврежденной ЦНС

Существует ряд рецепторов, которые передают сигнал в ответ на ГК [61]. Среди этих рецепторов CD44, рецептор HA-опосредованной подвижности (RHAMM), Stabilin-2 (HA рецептор для эндоцитоза), рецептор-1 гиалуроновой кислоты эндотелия лимфатических сосудов (LYVE-1) и HA-связывающие Toll-подобные рецепторы ( TLR-2 и TLR-4) экспрессируются либо в нормальной, либо в пораженной ЦНС.Роли большинства этих рецепторов в головном и спинном мозге не ясны. Однако несколько исследований показали, что CD44 участвует в развитии нервной системы, гомеостазе, восстановлении и реакции на повреждение.

5.1. CD44 повышается после поражения ЦНС и необходим для развития ЦНС

НА связывается с CD44 через внеклеточный домен, который имеет гомологию с белком хрящевой связи. Множественные формы CD44 образуются в результате обширного сплайсинга РНК и посттрансляционных модификаций [62], оба из которых могут изменять аффинность связывания HA с CD44.В общем, CD44 предпочтительно связывает высокомолекулярные формы НА, хотя низкомолекулярные формы НА могут также передавать сигнал через CD44. Было показано, что CD44 влияет на множественное клеточное поведение, включая выживание, пролиферацию, миграцию и дифференцировку, посредством взаимодействий с различными нижестоящими внутриклеточными сигнальными молекулами. Эти функции связаны с CD44-опосредованной передачей сигналов через цитоплазматический хвост CD44, который взаимодействует с рядом внутриклеточных белков, включая киназы семейства Src и членов семейства эзрин, радиксин, моэзин актин-ассоциированных белков, включая белок-супрессор опухоли мерлина [ 62].

CD44 экспрессируется как в центральной, так и в периферической нервной системе преимущественно глиальными клетками, хотя некоторые популяции нейронов по крайней мере временно CD44-положительны [5]. Параллельно с HA экспрессия CD44 увеличивается в пораженной ЦНС, что совпадает с глиозом [63]. Например, при травмах ЦНС CD44 хронически повышается в областях реактивного глиоза [64, 65]. CD44 также повышается после ишемии в головном мозге взрослых животных и людей [19, 21, 66, 67] и может влиять на воспалительные реакции после ишемического повреждения мозга [68].CD44 одинаково повышен в поражениях у пациентов [23] и овец [24] с перинатальными гипоксически-ишемическими повреждениями белого вещества головного мозга, в сером веществе старых макак [36] и у пациентов с признаками сосудистого повреждения мозга, связанного с возрастом. связанное с этим снижение когнитивных функций [39]. Наконец, экспрессия CD44 повышена в мышиной модели бокового амиотрофического склероза (БАС; [69]). В каждом из этих состояний CD44 локализуется в реактивных астроцитах или микроглии.

Демиелинизирующие поражения демонстрируют высокую экспрессию CD44 на реактивных астроцитах и ​​OPC в сочетании с повышенным уровнем НА [31, 63, 70].Повышение трансгенного CD44 в OPCs ведет к накоплению HA и сохранению OPCs, которые неспособны дифференцироваться в OL [71]. Эти мыши фенотипически сходны с мышами shiverer , у которых отсутствует миелин ЦНС. Более того, хроническое повышение уровня CD44 на OPCs приводит к накоплению перицеллюлярной HA [31]. Таким образом, хронически повышенный уровень CD44 может способствовать накоплению HA, что способствует нарушению созревания OPC. Остается неясным, требуется ли CD44 для воздействия продуктов расщепления НА на созревание и ремиелинизацию OPC.Напротив, потеря CD44 приводит к нарушению миграции OPC в демиелинизирующие поражения [50], предполагая, что CD44 может потребоваться для рекрутирования OPC после поражения ЦНС. Вместе эти находки предполагают, что экспрессия CD44 должна строго регулироваться в OPCs, чтобы гарантировать, что они эффективно мигрируют в поражения ЦНС и дифференцируются в миелинизирующие олигодендроциты.

CD44 также повышается в гиппокампе после судорог [25, 72]. Хотя значение этой экспрессии неясно, прорастание мшистых волокон можно ингибировать с помощью антител, блокирующих функцию CD44 [25].Более того, CD44 нулевые мыши демонстрируют дефицит обучения и памяти в гиппокампе, что согласуется с аномалиями функции гиппокампа у взрослых [73]. Эти данные предполагают, что, подобно OPCs, экспрессия CD44 клетками гиппокампа должна строго регулироваться для поддержания функции гиппокампа.

5.2. RHAMM может влиять на рост аксонов и подвижность глиальных клеток

Подобно CD44, RHAMM также существует во множестве изоформ и экспрессируется по крайней мере подмножествами нейронов и глиальных клеток, особенно олигодендроцитами [74].В отличие от CD44, RHAMM может функционировать как в цитоплазме, так и на поверхности клетки как заякоренный белок с гликофосфатидилинозитолом. Внутриклеточный RHAMM связывается с рядом структур, включая микротрубочки, актин, центросому и митотическое веретено, а также подосомы. Связывание HA с RHAMM может способствовать миграции и росту клеток за счет взаимодействий с различными внутриклеточными сигнальными молекулами, такими как киназа фокальной адгезии (FAK), вызывая изменения в актине и динамике микротрубочек [75]. Интересно, что RHAMM также может взаимодействовать с CD44, чтобы влиять на активность киназы, регулируемой внеклеточными сигналами (ERK), которая необходима для ускорения миграции клеток [76].

Подобно CD44, RHAMM наблюдается в астроцитах в периинфарктных областях после ишемии [20] и участвует в стимулировании роста аксонов и подвижности астроцитов и микроглии [77]. Однако неясно, как взаимодействия RHAMM-HA влияют на исход повреждения ЦНС. Интересно, что RHAMM может связываться с медиатором передачи сигналов кальмодулином кальций-зависимым образом [78], подтверждая роль RHAMM в опосредованной кальмодулином передаче сигналов клеток в ЦНС.

5.3. Toll-подобные рецепторы могут регулировать реакцию на продукты переваривания HA в поврежденной ЦНС

В ряде исследований было высказано предположение, что HA является лигандом для Toll-подобных рецепторов (TLR).Сообщалось, что как TLR2, так и TLR4 связывают HA [79], и их экспрессия была обнаружена в NSPCs [80], где они могут играть роль в регуляции нейрогенеза. TLR также экспрессируются микроглией и астроцитами [81]. Sloane с соавторами [32] сообщили, что TLR2 экспрессируется OPCs и что продукты переваривания HA, генерируемые гиалуронидазой, передают сигнал через TLR2, чтобы ингибировать созревание OPC, хотя не исключена роль дополнительных рецепторов в ответах OPC на продукты HA.

В целом, проведенные на сегодняшний день исследования подтверждают мнение о том, что несколько рецепторов HA участвуют в ответах нервной системы на повреждение, регулируя миграцию клеток, разрастание аксонов и дифференцировку.Что еще предстоит определить, так это то, как эти рецепторы взаимодействуют, чтобы влиять на каждое из этих клеточных поведений, как активация рецептора влияет на конкретные внутриклеточные сигнальные каскады и какие рецепторы реагируют на высокомолекулярную HA по сравнению с продуктами расщепления HA, генерируемыми гиалуронидазами.

6. Выводы

Синтез и катаболизм HA индуцируются при поражении различных тканей, включая ЦНС. После большинства, если не всех форм повреждения ЦНС, ECM на основе HA изначально нарушается, что приводит к потере HA в новых очагах поражения.Однако вскоре после начального поражения ЦНС НА накапливается преимущественно за счет активации транскрипции генов HAS астроцитами и другой реактивной глией. Накопление HA сопровождается активацией транскрипции CD44 и, возможно, других трансмембранных рецепторов HA, что приводит как к усилению передачи сигналов HA, так и к закреплению HA на клеточной поверхности, что способствует дальнейшему накоплению HA в микроокружении повреждения. Такое закрепление HA на поверхности клетки с помощью CD44 было описано в активированных эндотелиальных клетках головного мозга [82].В сочетании с транскрипционной активацией генов HAS и рецепторов HA также индуцируется экспрессия одной или нескольких гиалуронидаз, что приводит к перевариванию и удалению накопленного HA в очагах поражения. Баланс между накоплением HA и деградацией HA гиалуронидазами может влиять на ряд клеточных поведений, таких как пролиферация и дифференцировка в нишах NSPC (Рисунок 2). Интересно, что на экспрессию HAS, HA рецептора и гиалуронидазы может влиять одна и та же среда провоспалительных медиаторов, которые индуцируются после повреждения ткани.Нарушение баланса между синтезом и катаболизмом HA может привести либо к избыточному накоплению высокомолекулярной HA, либо к накоплению продуктов переваривания HA, которые могут отрицательно повлиять на восстановление ЦНС. Лучший пример этого последнего результата был продемонстрирован в случае неудачи ремиелинизации, когда накопление продуктов переваривания HA ингибирует созревание OPC в демиелинизирующих поражениях (Рисунок 3).



При заболеваниях и травмах ЦНС важно определить, в какой степени нарушение высокомолекулярной ГК по сравнению с накоплением продуктов переваривания ГК важно для выздоровления.Например, после приступов можно предположить, что поддержание матрицы HA важно для защиты перинейрональных сетей и, возможно, выживания и дифференцировки NSPC в нишах NSPC. Этого можно достичь путем блокирования активности или экспрессии гиалуронидазы, если гиалуронидазы участвуют в деградации HA в нишах NSPC, или путем повышения активности HAS. Ингибирование активности гиалуронидазы было эффективным в других биологических системах, включая блокирование роста опухоли по крайней мере в некоторых раковых клетках (например, в некоторых раковых клетках).g., [83]) и способствовать созреванию OPC [55]. Блокирование активации рецепторов, которые реагируют на продукты переваривания HA, также может быть эффективной стратегией для ускорения созревания OPC и миелинизации после перинатальной гипоксии-ишемии и при демиелинизирующих заболеваниях. По мере того, как вклад синтеза, катаболизма и передачи сигналов HA становится более ясным при различных типах поражений ЦНС, мы получим новые подсказки о том, как нацеливание на HA-синтазы, гиалуронидазы и рецепторы HA может привести к новым методам лечения, способствующим восстановлению ЦНС.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов в отношении публикации данной статьи.

Благодарности

Эта работа была поддержана Национальными институтами здравоохранения (NIH): награды NINDS: 1R01AG031892, OD011092, 1RO1NS054044 и R37NS045737-06S1 / 06S2 и Грант RG4843A5 / 1 от Национального общества рассеянного склероза.

% PDF-1.5 % 1 0 объект > >> эндобдж 4 0 объект / CreationDate (D: 20180813104116 + 01’00 ‘) / ModDate (D: 20180813104116 + 01’00 ‘) /Режиссер >> эндобдж 2 0 obj > эндобдж 3 0 obj > эндобдж 5 0 объект > / XObject> >> / Аннотации [85 0 R 86 0 R 87 0 R] / Родитель 2 0 R / MediaBox [0 0 595 842] >> эндобдж 6 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 92 0 руб. / Группа> / Вкладки / S / StructParents 0 >> эндобдж 7 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 95 0 руб. / Группа> / Вкладки / S / StructParents 11 >> эндобдж 8 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 97 0 руб. / Группа> / Вкладки / S / StructParents 12 >> эндобдж 9 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 98 0 руб. / Группа> / Вкладки / S / StructParents 13 >> эндобдж 10 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 99 0 руб. / Группа> / Вкладки / S / StructParents 14 >> эндобдж 11 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 100 0 руб. / Группа> / Вкладки / S / StructParents 15 >> эндобдж 12 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 101 0 руб. / Группа> / Вкладки / S / StructParents 16 >> эндобдж 13 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 102 0 руб. / Группа> / Вкладки / S / StructParents 17 >> эндобдж 14 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 103 0 руб. / Группа> / Вкладки / S / StructParents 18 >> эндобдж 15 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / Аннотации [104 0 R] / MediaBox [0 0 594.96 842,04] / Содержание 105 0 руб. / Группа> / Вкладки / S / StructParents 19 >> эндобдж 16 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 106 0 руб. / Группа> / Вкладки / S / StructParents 21 >> эндобдж 17 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 107 0 руб. / Группа> / Вкладки / S / StructParents 22 >> эндобдж 18 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 108 0 руб. / Группа> / Вкладки / S / StructParents 23 >> эндобдж 19 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 109 0 руб. / Группа> / Вкладки / S / StructParents 24 >> эндобдж 20 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 111 0 руб. / Группа> / Вкладки / S / StructParents 25 >> эндобдж 21 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 113 0 руб. / Группа> / Вкладки / S / StructParents 26 >> эндобдж 22 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 114 0 руб. / Группа> / Вкладки / S / StructParents 27 >> эндобдж 23 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 115 0 руб. / Группа> / Вкладки / S / StructParents 28 >> эндобдж 24 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 116 0 руб. / Группа> / Вкладки / S / StructParents 29 >> эндобдж 25 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 118 0 руб. / Группа> / Вкладки / S / StructParents 30 >> эндобдж 26 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 119 0 руб. / Группа> / Вкладки / S / StructParents 31 >> эндобдж 27 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 120 0 руб. / Группа> / Вкладки / S / StructParents 32 >> эндобдж 28 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 121 0 руб. / Группа> / Вкладки / S / StructParents 33 >> эндобдж 29 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 122 0 руб. / Группа> / Вкладки / S / StructParents 34 >> эндобдж 30 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 123 0 руб. / Группа> / Вкладки / S / StructParents 35 >> эндобдж 31 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 124 0 руб. / Группа> / Вкладки / S / StructParents 36 >> эндобдж 32 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 125 0 руб. / Группа> / Вкладки / S / StructParents 37 >> эндобдж 33 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 126 0 руб. / Группа> / Вкладки / S / StructParents 38 >> эндобдж 34 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 127 0 руб. / Группа> / Вкладки / S / StructParents 39 >> эндобдж 35 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 128 0 руб. / Группа> / Вкладки / S / StructParents 40 >> эндобдж 36 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 129 0 руб. / Группа> / Вкладки / S / StructParents 41 >> эндобдж 37 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 130 0 руб. / Группа> / Вкладки / S / StructParents 42 >> эндобдж 38 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 131 0 руб. / Группа> / Вкладки / S / StructParents 43 >> эндобдж 39 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 132 0 руб. / Группа> / Вкладки / S / StructParents 44 >> эндобдж 40 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 133 0 руб. / Группа> / Вкладки / S / StructParents 45 >> эндобдж 41 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 134 0 руб. / Группа> / Вкладки / S / StructParents 46 >> эндобдж 42 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 135 0 руб. / Группа> / Вкладки / S / StructParents 47 >> эндобдж 43 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 136 0 руб. / Группа> / Вкладки / S / StructParents 48 >> эндобдж 44 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 137 0 руб. / Группа> / Вкладки / S / StructParents 49 >> эндобдж 45 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 138 0 руб. / Группа> / Вкладки / S / StructParents 50 >> эндобдж 46 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 140 0 руб. / Группа> / Вкладки / S / StructParents 51 >> эндобдж 47 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 141 0 руб. / Группа> / Вкладки / S / StructParents 52 >> эндобдж 48 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 142 0 руб. / Группа> / Вкладки / S / StructParents 53 >> эндобдж 49 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 143 0 руб. / Группа> / Вкладки / S / StructParents 54 >> эндобдж 50 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 145 0 руб. / Группа> / Вкладки / S / StructParents 55 >> эндобдж 51 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 146 0 руб. / Группа> / Вкладки / S / StructParents 56 >> эндобдж 52 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 147 0 руб. / Группа> / Вкладки / S / StructParents 57 >> эндобдж 53 0 объект > / ExtGState> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 149 0 руб. / Группа> / Вкладки / S / StructParents 58 >> эндобдж 54 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 150 0 руб. / Группа> / Вкладки / S / StructParents 59 >> эндобдж 55 0 объект > / ExtGState> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 151 0 руб. / Группа> / Вкладки / S / StructParents 60 >> эндобдж 56 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 152 0 руб. / Группа> / Вкладки / S / StructParents 61 >> эндобдж 57 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 153 0 руб. / Группа> / Вкладки / S / StructParents 62 >> эндобдж 58 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 154 0 руб. / Группа> / Вкладки / S / StructParents 63 >> эндобдж 59 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 155 0 руб. / Группа> / Вкладки / S / StructParents 64 >> эндобдж 60 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 156 0 руб. / Группа> / Вкладки / S / StructParents 65 >> эндобдж 61 0 объект > / XObject> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 158 0 руб. / Группа> / Вкладки / S / StructParents 1 >> эндобдж 62 0 объект > / XObject> / ExtGState> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 160 0 руб. / Группа> / Вкладки / S / StructParents 2 >> эндобдж 63 0 объект > / XObject> / ExtGState> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 162 0 руб. / Группа> / Вкладки / S / StructParents 3 >> эндобдж 64 0 объект > / XObject> / ExtGState> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 164 0 руб. / Группа> / Вкладки / S / StructParents 4 >> эндобдж 65 0 объект > / XObject> / ExtGState> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 166 0 руб. / Группа> / Вкладки / S / StructParents 5 >> эндобдж 66 0 объект > / XObject> / ExtGState> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 168 0 руб. / Группа> / Вкладки / S / StructParents 6 >> эндобдж 67 0 объект > / ExtGState> / XObject> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 170 0 руб. / Группа> / Вкладки / S / StructParents 7 >> эндобдж 68 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 171 0 руб. / Группа> / Вкладки / S / StructParents 66 >> эндобдж 69 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 172 0 руб. / Группа> / Вкладки / S / StructParents 67 >> эндобдж 70 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 173 0 руб. / Группа> / Вкладки / S / StructParents 68 >> эндобдж 71 0 объект > / XObject> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 175 0 руб. / Группа> / Вкладки / S / StructParents 8 >> эндобдж 72 0 объект > / XObject> / ExtGState> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 177 0 руб. / Группа> / Вкладки / S / StructParents 9 >> эндобдж 73 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 178 0 руб. / Группа> / Вкладки / S / StructParents 69 >> эндобдж 74 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 179 0 руб. / Группа> / Вкладки / S / StructParents 70 >> эндобдж 75 0 объект > / XObject> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842,04] / Содержание 181 0 руб. / Группа> / Вкладки / S / StructParents 10 >> эндобдж 76 0 объект > / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] >> / MediaBox [0 0 594.96 842.04] / Содержание 182 0 руб. / Группа> / Вкладки / S / StructParents 71 >> эндобдж 77 0 объект > эндобдж 78 0 объект > эндобдж 79 0 объект > эндобдж 80 0 объект > транслировать xWr6} WS (2) Yl? 4N8t: ~ HPD

.

Leave a Reply

Ваш адрес email не будет опубликован.